ID: 1102886003

View in Genome Browser
Species Human (GRCh38)
Location 12:116522289-116522311
Sequence TGCGTTTGGTTTTGTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102886003_1102886007 6 Left 1102886003 12:116522289-116522311 CCAGGAAGACAAAACCAAACGCA No data
Right 1102886007 12:116522318-116522340 CCATCAGACTGAGCTGACCTTGG No data
1102886003_1102886009 30 Left 1102886003 12:116522289-116522311 CCAGGAAGACAAAACCAAACGCA No data
Right 1102886009 12:116522342-116522364 TGTGCACCCGTGCAGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102886003 Original CRISPR TGCGTTTGGTTTTGTCTTCC TGG (reversed) Intergenic