ID: 1102886004

View in Genome Browser
Species Human (GRCh38)
Location 12:116522303-116522325
Sequence TCTGATGGTGGACTTGCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102886004_1102886009 16 Left 1102886004 12:116522303-116522325 CCAAACGCAAGTCCACCATCAGA No data
Right 1102886009 12:116522342-116522364 TGTGCACCCGTGCAGAGCCCAGG No data
1102886004_1102886012 27 Left 1102886004 12:116522303-116522325 CCAAACGCAAGTCCACCATCAGA No data
Right 1102886012 12:116522353-116522375 GCAGAGCCCAGGACTATGCTAGG No data
1102886004_1102886007 -8 Left 1102886004 12:116522303-116522325 CCAAACGCAAGTCCACCATCAGA No data
Right 1102886007 12:116522318-116522340 CCATCAGACTGAGCTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102886004 Original CRISPR TCTGATGGTGGACTTGCGTT TGG (reversed) Intergenic