ID: 1102890137

View in Genome Browser
Species Human (GRCh38)
Location 12:116552503-116552525
Sequence TTCTACGAAGGCGCCCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102890133_1102890137 25 Left 1102890133 12:116552455-116552477 CCTTGAACAGACAAATAGTGAAT No data
Right 1102890137 12:116552503-116552525 TTCTACGAAGGCGCCCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102890137 Original CRISPR TTCTACGAAGGCGCCCACCC GGG Intergenic
No off target data available for this crispr