ID: 1102894504

View in Genome Browser
Species Human (GRCh38)
Location 12:116587910-116587932
Sequence TGGTGGGCCAATGTAAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102894504_1102894508 -10 Left 1102894504 12:116587910-116587932 CCATAGTTTACATTGGCCCACCA No data
Right 1102894508 12:116587923-116587945 TGGCCCACCACAGTGGGATTGGG No data
1102894504_1102894509 -9 Left 1102894504 12:116587910-116587932 CCATAGTTTACATTGGCCCACCA No data
Right 1102894509 12:116587924-116587946 GGCCCACCACAGTGGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102894504 Original CRISPR TGGTGGGCCAATGTAAACTA TGG (reversed) Intergenic
No off target data available for this crispr