ID: 1102895529

View in Genome Browser
Species Human (GRCh38)
Location 12:116595405-116595427
Sequence GAATTGCAACATATTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102895529_1102895534 8 Left 1102895529 12:116595405-116595427 CCTGGCCAAATATGTTGCAATTC No data
Right 1102895534 12:116595436-116595458 GGTTCCAACAGTGGTTGTCCAGG No data
1102895529_1102895533 -1 Left 1102895529 12:116595405-116595427 CCTGGCCAAATATGTTGCAATTC No data
Right 1102895533 12:116595427-116595449 CCTGCTAAAGGTTCCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102895529 Original CRISPR GAATTGCAACATATTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr