ID: 1102896426

View in Genome Browser
Species Human (GRCh38)
Location 12:116601927-116601949
Sequence AACTCTAGGCCGCATGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102896426_1102896437 25 Left 1102896426 12:116601927-116601949 CCTGTGCCATGCGGCCTAGAGTT No data
Right 1102896437 12:116601975-116601997 CTGAGACAAAGGGAGCATCTGGG No data
1102896426_1102896436 24 Left 1102896426 12:116601927-116601949 CCTGTGCCATGCGGCCTAGAGTT No data
Right 1102896436 12:116601974-116601996 TCTGAGACAAAGGGAGCATCTGG No data
1102896426_1102896433 14 Left 1102896426 12:116601927-116601949 CCTGTGCCATGCGGCCTAGAGTT No data
Right 1102896433 12:116601964-116601986 TCCTGGTTTGTCTGAGACAAAGG No data
1102896426_1102896435 15 Left 1102896426 12:116601927-116601949 CCTGTGCCATGCGGCCTAGAGTT No data
Right 1102896435 12:116601965-116601987 CCTGGTTTGTCTGAGACAAAGGG No data
1102896426_1102896431 -3 Left 1102896426 12:116601927-116601949 CCTGTGCCATGCGGCCTAGAGTT No data
Right 1102896431 12:116601947-116601969 GTTAGGGTGACCAACTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102896426 Original CRISPR AACTCTAGGCCGCATGGCAC AGG (reversed) Intergenic