ID: 1102896527

View in Genome Browser
Species Human (GRCh38)
Location 12:116602775-116602797
Sequence GGATCTACTAATTGTAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102896522_1102896527 24 Left 1102896522 12:116602728-116602750 CCTTAGAATACTTTGAGGCATTC No data
Right 1102896527 12:116602775-116602797 GGATCTACTAATTGTAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102896527 Original CRISPR GGATCTACTAATTGTAGCTA AGG Intergenic
No off target data available for this crispr