ID: 1102898854

View in Genome Browser
Species Human (GRCh38)
Location 12:116620483-116620505
Sequence GCGGAGGGAAGGCGTGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102898854_1102898863 7 Left 1102898854 12:116620483-116620505 CCTCTAACACGCCTTCCCTCCGC No data
Right 1102898863 12:116620513-116620535 ACATCCAGCATTTAAATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102898854 Original CRISPR GCGGAGGGAAGGCGTGTTAG AGG (reversed) Intergenic
No off target data available for this crispr