ID: 1102900901

View in Genome Browser
Species Human (GRCh38)
Location 12:116635972-116635994
Sequence CAGTGTGAACAAAGTGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102900899_1102900901 29 Left 1102900899 12:116635920-116635942 CCAGATAACTCATAAAAGCAAGA No data
Right 1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102900901 Original CRISPR CAGTGTGAACAAAGTGAAGT TGG Intergenic
No off target data available for this crispr