ID: 1102908886

View in Genome Browser
Species Human (GRCh38)
Location 12:116697509-116697531
Sequence TAGTCTCCAGTGTCCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908886_1102908896 14 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908896 12:116697546-116697568 ACATTCGGGGTTGTCATAGCTGG No data
1102908886_1102908897 15 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908897 12:116697547-116697569 CATTCGGGGTTGTCATAGCTGGG No data
1102908886_1102908899 23 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908899 12:116697555-116697577 GTTGTCATAGCTGGGGATGCTGG No data
1102908886_1102908898 16 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908886_1102908894 1 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908886_1102908892 -1 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908892 12:116697531-116697553 AGGCCATGTCTGGAGACATTCGG No data
1102908886_1102908893 0 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908886 Original CRISPR TAGTCTCCAGTGTCCTCTGG GGG (reversed) Intergenic