ID: 1102908890

View in Genome Browser
Species Human (GRCh38)
Location 12:116697512-116697534
Sequence GCCTAGTCTCCAGTGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908890_1102908897 12 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908897 12:116697547-116697569 CATTCGGGGTTGTCATAGCTGGG No data
1102908890_1102908900 30 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908900 12:116697565-116697587 CTGGGGATGCTGGCTCCTACCGG No data
1102908890_1102908894 -2 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908890_1102908893 -3 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908890_1102908898 13 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908890_1102908892 -4 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908892 12:116697531-116697553 AGGCCATGTCTGGAGACATTCGG No data
1102908890_1102908896 11 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908896 12:116697546-116697568 ACATTCGGGGTTGTCATAGCTGG No data
1102908890_1102908899 20 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908899 12:116697555-116697577 GTTGTCATAGCTGGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908890 Original CRISPR GCCTAGTCTCCAGTGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr