ID: 1102908893

View in Genome Browser
Species Human (GRCh38)
Location 12:116697532-116697554
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908885_1102908893 1 Left 1102908885 12:116697508-116697530 CCCCCCAGAGGACACTGGAGACT No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908887_1102908893 -1 Left 1102908887 12:116697510-116697532 CCCCAGAGGACACTGGAGACTAG No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908886_1102908893 0 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908888_1102908893 -2 Left 1102908888 12:116697511-116697533 CCCAGAGGACACTGGAGACTAGG No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908882_1102908893 30 Left 1102908882 12:116697479-116697501 CCAGTGGCTCTCAACTAGTGGCG No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data
1102908890_1102908893 -3 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908893 12:116697532-116697554 GGCCATGTCTGGAGACATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908893 Original CRISPR GGCCATGTCTGGAGACATTC GGG Intergenic
No off target data available for this crispr