ID: 1102908894

View in Genome Browser
Species Human (GRCh38)
Location 12:116697533-116697555
Sequence GCCATGTCTGGAGACATTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908885_1102908894 2 Left 1102908885 12:116697508-116697530 CCCCCCAGAGGACACTGGAGACT No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908886_1102908894 1 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908888_1102908894 -1 Left 1102908888 12:116697511-116697533 CCCAGAGGACACTGGAGACTAGG No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908887_1102908894 0 Left 1102908887 12:116697510-116697532 CCCCAGAGGACACTGGAGACTAG No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data
1102908890_1102908894 -2 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908894 12:116697533-116697555 GCCATGTCTGGAGACATTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908894 Original CRISPR GCCATGTCTGGAGACATTCG GGG Intergenic
No off target data available for this crispr