ID: 1102908895

View in Genome Browser
Species Human (GRCh38)
Location 12:116697534-116697556
Sequence ACCCCGAATGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908895_1102908901 16 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908901 12:116697573-116697595 GCTGGCTCCTACCGGCATCTAGG No data
1102908895_1102908903 18 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908903 12:116697575-116697597 TGGCTCCTACCGGCATCTAGGGG No data
1102908895_1102908902 17 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908902 12:116697574-116697596 CTGGCTCCTACCGGCATCTAGGG No data
1102908895_1102908899 -2 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908899 12:116697555-116697577 GTTGTCATAGCTGGGGATGCTGG No data
1102908895_1102908905 22 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908905 12:116697579-116697601 TCCTACCGGCATCTAGGGGGTGG No data
1102908895_1102908900 8 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908900 12:116697565-116697587 CTGGGGATGCTGGCTCCTACCGG No data
1102908895_1102908898 -9 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908895_1102908908 27 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908908 12:116697584-116697606 CCGGCATCTAGGGGGTGGAGAGG No data
1102908895_1102908897 -10 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908897 12:116697547-116697569 CATTCGGGGTTGTCATAGCTGGG No data
1102908895_1102908904 19 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908904 12:116697576-116697598 GGCTCCTACCGGCATCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908895 Original CRISPR ACCCCGAATGTCTCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr