ID: 1102908898

View in Genome Browser
Species Human (GRCh38)
Location 12:116697548-116697570
Sequence ATTCGGGGTTGTCATAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908888_1102908898 14 Left 1102908888 12:116697511-116697533 CCCAGAGGACACTGGAGACTAGG No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908887_1102908898 15 Left 1102908887 12:116697510-116697532 CCCCAGAGGACACTGGAGACTAG No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908895_1102908898 -9 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908890_1102908898 13 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908886_1102908898 16 Left 1102908886 12:116697509-116697531 CCCCCAGAGGACACTGGAGACTA No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data
1102908885_1102908898 17 Left 1102908885 12:116697508-116697530 CCCCCCAGAGGACACTGGAGACT No data
Right 1102908898 12:116697548-116697570 ATTCGGGGTTGTCATAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908898 Original CRISPR ATTCGGGGTTGTCATAGCTG GGG Intergenic
No off target data available for this crispr