ID: 1102908900

View in Genome Browser
Species Human (GRCh38)
Location 12:116697565-116697587
Sequence CTGGGGATGCTGGCTCCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908890_1102908900 30 Left 1102908890 12:116697512-116697534 CCAGAGGACACTGGAGACTAGGC No data
Right 1102908900 12:116697565-116697587 CTGGGGATGCTGGCTCCTACCGG No data
1102908895_1102908900 8 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908900 12:116697565-116697587 CTGGGGATGCTGGCTCCTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908900 Original CRISPR CTGGGGATGCTGGCTCCTAC CGG Intergenic
No off target data available for this crispr