ID: 1102908903

View in Genome Browser
Species Human (GRCh38)
Location 12:116697575-116697597
Sequence TGGCTCCTACCGGCATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102908895_1102908903 18 Left 1102908895 12:116697534-116697556 CCATGTCTGGAGACATTCGGGGT No data
Right 1102908903 12:116697575-116697597 TGGCTCCTACCGGCATCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102908903 Original CRISPR TGGCTCCTACCGGCATCTAG GGG Intergenic
No off target data available for this crispr