ID: 1102909950

View in Genome Browser
Species Human (GRCh38)
Location 12:116705687-116705709
Sequence GTTGCACGCCACTGCGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102909950_1102909956 25 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG 0: 1
1: 0
2: 0
3: 8
4: 157
1102909950_1102909954 17 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909954 12:116705727-116705749 CATCCTTCAAAGCCCTTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 167
1102909950_1102909953 16 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909953 12:116705726-116705748 TCATCCTTCAAAGCCCTTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102909950 Original CRISPR GTTGCACGCCACTGCGGAGT TGG (reversed) Intergenic
902732539 1:18378756-18378778 GTTGCATGCCACTGAGGTTTGGG - Intergenic
905962123 1:42051956-42051978 GGTGAACGCCACTGAAGAGTAGG - Intergenic
923101292 1:230819844-230819866 GCTTCACTCCACTGCAGAGTTGG - Intergenic
1084741715 11:71144311-71144333 GTTGCACCTGACTGCAGAGTAGG - Intronic
1092160552 12:6313156-6313178 GCTGCACGCCCCTGGGGAGAAGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG + Intronic
1123493475 15:20800373-20800395 ATTCCAGGCCGCTGCGGAGTGGG - Intergenic
1123549983 15:21369475-21369497 ATTCCAGGCCGCTGCGGAGTGGG - Intergenic
1124108562 15:26764773-26764795 GCTCCACGGCACTGCTGAGTGGG + Intronic
1126962968 15:54018585-54018607 GTTGCTGGCCCCTGCTGAGTTGG + Intronic
1202958313 15_KI270727v1_random:96693-96715 ATTCCAGGCCGCTGCGGAGTGGG - Intergenic
1132588731 16:717219-717241 GGTGGACGCCACAGCGCAGTGGG - Exonic
1134662069 16:15991771-15991793 GTTCAAGGCCACTGCAGAGTCGG - Intronic
1142049499 16:87949077-87949099 GTTGAAGGCCACTGCTGACTAGG - Intergenic
1142309804 16:89305882-89305904 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1142309973 16:89306681-89306703 GTGGCACGTGTCTGCGGAGTGGG - Intronic
1144758580 17:17694661-17694683 GTGGGACGCCACCGCGGAGGAGG - Intronic
1145393874 17:22478537-22478559 TCTGCACACCACTGCGGGGTTGG - Intergenic
1151603871 17:75124250-75124272 GTTCCCTGCCACTGCGGAGAGGG + Intronic
1161535689 19:4817463-4817485 GGTGCACTCCACTGGGTAGTTGG + Exonic
932947842 2:76258199-76258221 GTTGCATGGCACTGTGGACTTGG - Intergenic
941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG + Intergenic
1184862395 22:47180450-47180472 GTTGCAAGCCACTGTGGGGTGGG - Intergenic
963535675 3:146525118-146525140 GATGCAGGCCACTGCAGTGTGGG - Intronic
969460246 4:7325169-7325191 GGTGCAGGGCACTGGGGAGTAGG + Intronic
980550430 4:134327965-134327987 GTTTCCCGCCAATGGGGAGTTGG + Intergenic
986232583 5:5880242-5880264 GTTACATGCCACTGCGGAAGGGG + Intergenic
988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG + Intergenic
988681735 5:33490167-33490189 TCTGCACCCCACTGGGGAGTTGG - Intergenic
997899927 5:137754703-137754725 CGCGAACGCCACTGCGGAGTTGG - Intergenic
1016820714 6:148343317-148343339 GAAGGACGCCTCTGCGGAGTGGG - Intronic
1019804910 7:3116730-3116752 GCTGCAGGCCACTGCAGAATGGG - Intergenic
1025989160 7:66482374-66482396 GTTGCACGCCAGTCAGGTGTGGG + Intergenic
1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG + Intronic
1030350255 7:108476966-108476988 GTTGCCAGACACTGGGGAGTAGG + Intronic
1037102555 8:15065172-15065194 GTAGCAAGGCACAGCGGAGTGGG - Intronic
1039284567 8:36026696-36026718 GTTGTCCGCCATTGCTGAGTAGG + Intergenic
1046679964 8:117157817-117157839 GTTGGCCGCCACTGCGCAGCTGG - Exonic
1049906026 9:216841-216863 CTTGCAAGCAACTGCGGGGTCGG + Intronic
1054783965 9:69192717-69192739 GCAGCACGCTACTGAGGAGTAGG - Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic