ID: 1102909953

View in Genome Browser
Species Human (GRCh38)
Location 12:116705726-116705748
Sequence TCATCCTTCAAAGCCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102909949_1102909953 17 Left 1102909949 12:116705686-116705708 CCCAACTCCGCAGTGGCGTGCAA 0: 1
1: 0
2: 0
3: 7
4: 42
Right 1102909953 12:116705726-116705748 TCATCCTTCAAAGCCCTTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 151
1102909951_1102909953 10 Left 1102909951 12:116705693-116705715 CCGCAGTGGCGTGCAACTCACTT 0: 1
1: 0
2: 2
3: 5
4: 81
Right 1102909953 12:116705726-116705748 TCATCCTTCAAAGCCCTTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 151
1102909950_1102909953 16 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909953 12:116705726-116705748 TCATCCTTCAAAGCCCTTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102909953 Original CRISPR TCATCCTTCAAAGCCCTTTA AGG Intergenic
902556730 1:17251119-17251141 TCATCCTTCAAGGCTCTGAATGG - Intronic
902784286 1:18722945-18722967 TCATCCCTCAAACCCCTCCAAGG + Intronic
903030000 1:20457123-20457145 TCATCCTTCAAAACTCTGTTCGG - Intergenic
906245869 1:44273762-44273784 TCATCCTTCAAAACCCTTGTGGG - Intronic
906471910 1:46138165-46138187 GCATGCTTTAAAGCCCTATATGG - Intronic
907768941 1:57440393-57440415 TCATCCATCAAAGGCATATAAGG + Intronic
909105856 1:71407413-71407435 GAATCCTTAAAAGCCTTTTATGG + Exonic
916691786 1:167196868-167196890 ACATCCTTTCAAGCCCTTTCTGG - Intergenic
924445552 1:244126975-244126997 AGATGCTTCAAAGCCCTTCATGG - Intergenic
1062815006 10:492957-492979 TCATATTTCTAAGCCCTTCAGGG - Intronic
1069237413 10:66094378-66094400 TCATACATAAAAGCCCTTTTAGG - Intronic
1070089949 10:73274811-73274833 GCATTCTTCAAAGCCATTTTGGG + Intronic
1072521726 10:96235702-96235724 TCATCCTTCAAGGCCCCATTCGG - Intronic
1073146474 10:101284979-101285001 TCTTCCTGCAAAGCCCTGCATGG - Intergenic
1074176063 10:111004501-111004523 TCACCCCCCAAAGCCCTTTGAGG + Intronic
1075636932 10:124035769-124035791 TCATCCTTCAAAACCCAGTCTGG + Intronic
1075828007 10:125377142-125377164 TTCTCCTTCTAAGCCCTTTGTGG + Intergenic
1076222288 10:128744172-128744194 GCATCCATCAATGACCTTTACGG - Intergenic
1078747420 11:14128602-14128624 TCATCCTTCAGACCCCTGAATGG - Intronic
1081764624 11:45601128-45601150 TCATCCTTTAAAGGACTTCAGGG + Intergenic
1083401049 11:62423741-62423763 CCATCCTTCAAAGCTTTCTAGGG + Intergenic
1085929119 11:81059443-81059465 TCATTCTGCAAAGCCCTGTGTGG + Intergenic
1087056753 11:93944521-93944543 CCGCCCTCCAAAGCCCTTTATGG + Intergenic
1091791751 12:3275940-3275962 TCATTCTTCAAAGCCCAGCAAGG + Intronic
1094587599 12:31792324-31792346 CCATTCTTCAAAGCCCATTTCGG + Intergenic
1097143955 12:56926835-56926857 TCATCCTTCAAAACTCACTAAGG + Intronic
1097484611 12:60179948-60179970 TCAAGCTTCAAAGCCCTCTGAGG + Intergenic
1097846744 12:64374378-64374400 TCATCCTTCAAAGCCCAGACTGG - Intronic
1097980319 12:65731441-65731463 ACATCCCTCAGAGCCCTTTGTGG - Intergenic
1098417434 12:70251422-70251444 TAATCCTCCATAGCCCTTGATGG + Intronic
1098580266 12:72091275-72091297 ACTTCCTTCAAATCCCTATATGG + Intronic
1099171121 12:79365494-79365516 TCATCTTTCAAATTCATTTATGG - Intronic
1100014699 12:89994995-89995017 TCATCCTCAAAAGCCCTTCTTGG - Intergenic
1101577002 12:106006981-106007003 TCATCCTTCACAACCCATAAGGG + Intergenic
1102909953 12:116705726-116705748 TCATCCTTCAAAGCCCTTTAAGG + Intergenic
1106931155 13:34667285-34667307 TCATCCTAGACAGCCCTTCAAGG + Intergenic
1107437710 13:40394907-40394929 TCAGCCTCCAAAGGCCTATAGGG - Intergenic
1107631459 13:42347380-42347402 TCGTAATTCAAAGCCATTTAAGG - Intergenic
1110955096 13:81544520-81544542 TCAATTTTCAAAGCCATTTATGG + Intergenic
1113876746 13:113599529-113599551 TCATCCTTCGAAACCCTCAAAGG + Intronic
1115132417 14:30069515-30069537 TCATCCTTCAAAACTCTCTCAGG + Intronic
1116630625 14:47326889-47326911 TCATCAGTCAAAGCCCTGTCGGG + Intronic
1117085245 14:52194205-52194227 TTTTCCTTCAAAGACATTTATGG - Intergenic
1119014092 14:71031375-71031397 TCATCCCTCAAAGCCCAGCAAGG + Intronic
1119132852 14:72190605-72190627 TCATCCCTGAAAGCCCCATAAGG - Intronic
1120566271 14:86062059-86062081 TCTTCCTTCACAGACCTTTGAGG - Intergenic
1120721903 14:87898488-87898510 TCAGCCTTCAAAGCCCATGGAGG + Intronic
1125706000 15:41736755-41736777 TGATTTTTCAGAGCCCTTTATGG + Intronic
1127835973 15:62791454-62791476 TCTTCCTTTAAACCCCTTAAAGG - Intronic
1128656669 15:69467707-69467729 GCATCCTCAAAAGCCCTTCATGG - Intergenic
1129414851 15:75369892-75369914 TCATCCCACAAAGCTCTTTTTGG + Exonic
1129705083 15:77789726-77789748 TCATCCTTCACAGCCTTTGGAGG + Intronic
1133890400 16:9873999-9874021 TCATTCTACAACTCCCTTTAAGG + Intronic
1134802818 16:17101096-17101118 TCACCCTTCAAAATCCTTAAAGG - Intergenic
1137774555 16:51044316-51044338 TCATCCTTCGGAGCCCTTCCTGG - Intergenic
1144525078 17:15982403-15982425 ACAGCCTTCAAAGCACTTTTAGG + Intronic
1148663610 17:49357627-49357649 TGATTCTACAAAGCACTTTATGG + Intronic
1149132066 17:53314812-53314834 TCATCCTCCAAAGTGCTTTTTGG - Intergenic
1150012462 17:61517927-61517949 TCATCCTTCAAATCCCTTAAAGG + Intergenic
1150012540 17:61518789-61518811 TTATCCTTCAAATCCCTTAAAGG + Intergenic
1151870943 17:76836346-76836368 TAATCCTTCAACTTCCTTTATGG + Intergenic
1157498012 18:48170348-48170370 TCATCCATCAAAGCTCTTGGGGG + Intronic
1157740936 18:50092175-50092197 TCTTACTTGAAATCCCTTTAAGG - Intronic
1158265860 18:55660040-55660062 TCATTCTTCAAAGCCCAGTTCGG - Intronic
1163488409 19:17603054-17603076 TCGTCCTTCAAAACCCATCACGG - Exonic
1163659381 19:18567704-18567726 TCAGCCTGCAGAGCCCTTTAAGG - Intronic
1164957019 19:32395121-32395143 CCATCCTCCTAAGCCCTTCAAGG + Intergenic
1168610118 19:57792300-57792322 TCATCCTTCACAGCCATGTCTGG - Intronic
928318554 2:30265219-30265241 TCATCTTTCAAATCCCATCATGG + Intronic
931105700 2:59052944-59052966 TCATCCCTAAGTGCCCTTTATGG + Intergenic
935866101 2:107389223-107389245 TCTTCCCTCACAGCCCTTGAAGG + Intergenic
944344540 2:198646225-198646247 TGATTCTTGCAAGCCCTTTAAGG - Intergenic
947516644 2:230811104-230811126 TCATTCTTCTAACCTCTTTACGG - Intronic
947907343 2:233775136-233775158 CCCTCCTTCAAAGCCCTTCCTGG + Intergenic
948338507 2:237230508-237230530 TCATGCTTCCATGCCTTTTAGGG - Intergenic
1168783254 20:513375-513397 TCATGTTTCTAAGCCCTTTCTGG - Intronic
1172107663 20:32526435-32526457 CCATCCTTAAAATCCATTTAGGG + Intronic
1172114256 20:32564231-32564253 TCATCCTTCAGAGCACTGCAGGG + Intronic
1173758129 20:45535993-45536015 TCATTCTTTAAAACCCTTTCCGG + Intronic
1176969265 21:15247085-15247107 TCATCCTTCTAAGCATTCTATGG + Intergenic
1177485071 21:21746237-21746259 TCATCCTCCAGAGCCCATAATGG + Intergenic
1177542273 21:22510050-22510072 TCAGACTGTAAAGCCCTTTAGGG + Intergenic
1177613517 21:23486630-23486652 TCATCCTGGAAAGTCCTTTTAGG - Intergenic
1179374159 21:40834582-40834604 TCCTCCATCAAAGACCTTTAGGG + Intronic
1181572550 22:23775444-23775466 TCATCTTTCCAAGTCCTTTCTGG - Intronic
1181968079 22:26670503-26670525 TCATCCTTCAAGGCCCTGTTTGG - Intergenic
1182114140 22:27745328-27745350 TCATCCTTCAAAACCCTACCTGG - Intergenic
1182114231 22:27745982-27746004 TCATCCTTCAAAACCCTCTCTGG + Intergenic
1182835054 22:33335074-33335096 TCATCCTGCAAGGCTTTTTATGG + Intronic
1183324869 22:37185714-37185736 TCATCCTTCCAAGGCCTGTGTGG - Intronic
1184468537 22:44682950-44682972 TCATCCTGCAAAACCCTTCTTGG - Intronic
949552640 3:5123796-5123818 TCATTCTTCAAAGGACTTTGGGG - Intronic
955451183 3:59068066-59068088 TATTCCTTCTAAGTCCTTTAGGG + Intergenic
957001558 3:74892722-74892744 TCCTCCTACAAATCCCCTTATGG - Intergenic
957345663 3:78958318-78958340 TTTTAGTTCAAAGCCCTTTAAGG - Intronic
958187710 3:90144512-90144534 TCATCCTGCAAAGTCCTCTTAGG - Intergenic
958813944 3:98894982-98895004 TCAGCCTTCAAAACCCTTCTTGG - Intronic
959525164 3:107368415-107368437 CCAATCCTCAAAGCCCTTTATGG - Intergenic
960322001 3:116248257-116248279 TCATCCTTCAAGGTCCTGAAAGG - Intronic
961642038 3:128370796-128370818 TCTTTCTCCAAAGCCCTGTAGGG - Intronic
965021333 3:163235858-163235880 TCATCATGCAATGCCCATTAAGG - Intergenic
965591196 3:170361581-170361603 ACATACTGCAAAGCACTTTATGG - Intronic
965994345 3:174861656-174861678 TCATTATTCAAAGCACTTGATGG - Intronic
968945027 4:3659021-3659043 ACATCCTCCAGAGCCCTTTCTGG - Intergenic
969140438 4:5066529-5066551 ACATCCTTCAGAACCCTGTATGG + Intronic
971419746 4:26464656-26464678 CCATGCCTCACAGCCCTTTAGGG - Intergenic
973343584 4:49030853-49030875 TGATGCTTCTAAGCCCTATATGG + Exonic
977102411 4:92833369-92833391 TCATTCTTGACAGCCCTTGATGG - Intronic
978831212 4:113087165-113087187 TCATCCTTCAAATCCCATTTCGG - Intronic
979099751 4:116599573-116599595 TCTTCCTCCACAGCCCTGTATGG + Intergenic
980996622 4:139785381-139785403 TCCTCCTTCACAGCCCTTCCAGG - Intronic
982558896 4:156904284-156904306 TCATAATTAAAAGCCTTTTATGG + Intronic
982916859 4:161222423-161222445 TTATCCTTCAAACCACCTTATGG - Intergenic
983465002 4:168075929-168075951 ACATCATACAAAGCCCGTTAAGG + Intergenic
984288991 4:177768748-177768770 TCATCCTCCAAAAGCCATTAGGG - Intronic
985680726 5:1254301-1254323 TCATCCTTGAACGCCCTGTGTGG - Intronic
989196562 5:38722395-38722417 TCCATTTTCAAAGCCCTTTATGG + Intergenic
990403645 5:55466003-55466025 TCATTCCTCAAAGCCATTTCTGG + Intronic
990974519 5:61547377-61547399 TCAACCTTCAAATCACTTCATGG - Intergenic
991961159 5:72045676-72045698 TCATCCTACAAACCCCCTTTTGG - Intergenic
995530638 5:113088701-113088723 TTCTCTTTCAAAGCCCTTTGAGG + Intronic
1000551431 5:162670250-162670272 TCATCCTTCATGGCACATTAAGG + Intergenic
1000683126 5:164211826-164211848 TCATCCTTCCAAGTCCTTTCAGG - Intergenic
1001692644 5:173644336-173644358 TCAGCCTGCAATGCCCTTTCTGG + Intergenic
1004567515 6:16812636-16812658 TCATCCTTCAAGGCCTTCGAAGG + Intergenic
1005459213 6:26052493-26052515 TTTTCCTTCAATGCCCTTTGGGG - Intergenic
1006423494 6:33949806-33949828 TCATCCTGCAAGGCCCTATTTGG - Intergenic
1013013270 6:106138741-106138763 TCAACATTCTAAGCCCTTTAGGG - Intergenic
1013702527 6:112790607-112790629 ACACCCTTCAAGGCCCTTCATGG + Intergenic
1015190581 6:130467646-130467668 TCATCTTTGAAAGACCTTTCTGG - Intergenic
1015264751 6:131279661-131279683 TCAACCTCCAAATCCCTTTTGGG - Intronic
1015277113 6:131394835-131394857 GAATTTTTCAAAGCCCTTTATGG + Intergenic
1015396013 6:132735703-132735725 TCATCCTTATAAGTCCCTTAAGG + Intergenic
1017345318 6:153372671-153372693 TCATCTTTCAAAGCGATTAATGG - Intergenic
1022668871 7:32436571-32436593 TCATCCCTCAATGCCCATTTGGG - Intergenic
1023612757 7:41988070-41988092 TCATTCTTCAAAGTGCCTTAAGG + Intronic
1023887034 7:44366109-44366131 TCATCCTTCAAAGCCAGCAATGG + Intergenic
1031709585 7:125028822-125028844 TCATCCTCCAAAGCCCATAAAGG - Intergenic
1032937891 7:136755077-136755099 TCAGCTTTCAAAGCCTTTGAAGG + Intergenic
1035529169 8:337570-337592 TCTTCCCTCAAAGCCCTGAAAGG - Intergenic
1036935009 8:12993233-12993255 TCCTTCTTGAAAGCCCTTCAGGG - Intronic
1037784906 8:21896791-21896813 TCATCCTTCAGAGTCCTGCATGG - Intergenic
1039246930 8:35619257-35619279 TCATACTTCAAAAGCCTATATGG - Intronic
1044420749 8:91993294-91993316 CCATCCTTTATGGCCCTTTAGGG + Intronic
1045327197 8:101126310-101126332 CTATTCTACAAAGCCCTTTAGGG - Intergenic
1047422866 8:124721694-124721716 TCTTCCCTCAAAGCCTTTTCTGG - Intronic
1048210878 8:132453282-132453304 CCATGGTTCAAAGCCCTTCAGGG - Intronic
1049479869 8:142816794-142816816 TCATCCTTCACAGGCTTTTCTGG + Intergenic
1050004869 9:1119472-1119494 TTATCCTTCAAAACCCATTAGGG - Intergenic
1055686720 9:78782898-78782920 CCATCCATCAACCCCCTTTATGG - Intergenic
1056706557 9:88956825-88956847 TCCACCCTCAAAGCCCTTGAGGG + Intergenic
1057529290 9:95830178-95830200 GCATTCTTCAAAGCCCTTAGTGG - Intergenic
1058457732 9:105153514-105153536 TCATCTTTCAAATCCCCTTCTGG + Intergenic
1185803781 X:3038168-3038190 TTATCCCTCAAAGACCTTTGAGG + Intergenic
1187437646 X:19287390-19287412 ACTTCCTTCAAAGCCCATGATGG - Intergenic
1190998366 X:55634977-55634999 TCACCTTCCAAAGCCCTTGAGGG - Intergenic
1192236774 X:69301152-69301174 TCATCCTTCAAACGCCTTCGTGG + Intergenic
1195247642 X:103009391-103009413 GCAACCTTCAAAGCACATTAGGG - Intergenic
1195777007 X:108417830-108417852 TCATCCTTCAGAGAACTCTAAGG + Intronic
1196943129 X:120797365-120797387 TCAGCCTTCCAAGCTCATTATGG - Intergenic
1199200897 X:145087958-145087980 TCATCCTTCAGACCCCATAATGG + Intergenic
1200065963 X:153504192-153504214 GAATTCTTCAAAGCCCTTGAGGG + Intronic
1201276932 Y:12307736-12307758 TTATCCCTCAAAGACCTTTGAGG - Intergenic
1201960403 Y:19674881-19674903 TCTGCATTCTAAGCCCTTTATGG - Intergenic