ID: 1102909954

View in Genome Browser
Species Human (GRCh38)
Location 12:116705727-116705749
Sequence CATCCTTCAAAGCCCTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102909951_1102909954 11 Left 1102909951 12:116705693-116705715 CCGCAGTGGCGTGCAACTCACTT 0: 1
1: 0
2: 2
3: 5
4: 81
Right 1102909954 12:116705727-116705749 CATCCTTCAAAGCCCTTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 167
1102909950_1102909954 17 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909954 12:116705727-116705749 CATCCTTCAAAGCCCTTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 167
1102909949_1102909954 18 Left 1102909949 12:116705686-116705708 CCCAACTCCGCAGTGGCGTGCAA 0: 1
1: 0
2: 0
3: 7
4: 42
Right 1102909954 12:116705727-116705749 CATCCTTCAAAGCCCTTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102909954 Original CRISPR CATCCTTCAAAGCCCTTTAA GGG Intergenic
901755504 1:11439180-11439202 CTTCCTTCAAAGTGCTTTCATGG + Intergenic
902784287 1:18722946-18722968 CATCCCTCAAACCCCTCCAAGGG + Intronic
906003118 1:42444488-42444510 CAGACTTCAAAGCACTTTCATGG + Intronic
906532738 1:46532927-46532949 CTTCCTTCAGTGCCATTTAAGGG - Intergenic
906590370 1:47019410-47019432 CATGCTTCAAAGCCCAGGAAAGG + Intergenic
907690589 1:56660900-56660922 CATCCTTTAGAGAACTTTAAAGG + Intronic
909105857 1:71407414-71407436 AATCCTTAAAAGCCTTTTATGGG + Exonic
909600809 1:77459213-77459235 CTTCCTTAAAACCCTTTTAATGG + Intronic
909847865 1:80418519-80418541 CATAATTTAAAGCACTTTAAAGG + Intergenic
916691785 1:167196867-167196889 CATCCTTTCAAGCCCTTTCTGGG - Intergenic
918386522 1:184013649-184013671 AAACCTTCAAAGACCTTTGAGGG - Intronic
918410855 1:184256614-184256636 AAACCTTCAAAGGGCTTTAAGGG + Intergenic
918425587 1:184406613-184406635 CTTCCTGAATAGCCCTTTAAAGG - Intronic
919483652 1:198119934-198119956 CTTCCTTTAAAGCCTTTTAAAGG + Intergenic
920916361 1:210261245-210261267 CTTCCTTCTAAGATCTTTAAGGG - Intergenic
921163871 1:212491982-212492004 CTTCCGAGAAAGCCCTTTAAAGG + Intergenic
921646836 1:217629396-217629418 CCTCCTTCAATTCTCTTTAAAGG - Intronic
923480070 1:234375548-234375570 CCTCCTTCAGAGCCTTTTAAAGG - Intronic
923908132 1:238408833-238408855 CTTCCTTCAAAGAGCTTTACTGG - Intergenic
924445551 1:244126974-244126996 GATGCTTCAAAGCCCTTCATGGG - Intergenic
1065429691 10:25640718-25640740 CATACTTCAAGGCCCTGGAATGG - Intergenic
1065820413 10:29520163-29520185 CTTCTTTCAAAGGCTTTTAAAGG - Intronic
1066193539 10:33077473-33077495 CATGCTTCAAATCCCTTTCCAGG - Intergenic
1067903021 10:50262171-50262193 TATCCTTGAAAGCCCTTTGGAGG + Intergenic
1067995168 10:51264236-51264258 CAACCTTCAAATATCTTTAATGG - Intronic
1069927302 10:71859712-71859734 CATCCTTCAAAATCCATTTAAGG + Intergenic
1070106527 10:73437823-73437845 CATCCTTTAAAGACATTTCATGG + Exonic
1076768268 10:132649488-132649510 CAACCTTCAACACGCTTTAAAGG - Intronic
1079928486 11:26526463-26526485 CATCCTTCAACATCATTTAATGG - Intronic
1080278445 11:30528763-30528785 CATCTTTTAAAACCCTTTAAAGG + Intronic
1080286561 11:30620808-30620830 CATTATTGAAAGTCCTTTAATGG + Intergenic
1081261432 11:40966075-40966097 GGTCCTTCACATCCCTTTAAGGG + Intronic
1086137828 11:83460414-83460436 CAACCCTCAAAGCCCTTAATAGG + Intronic
1088540020 11:110903719-110903741 AATCCTGCAAAGGCCTGTAAAGG - Intergenic
1095260489 12:40093713-40093735 CATCCTTCCAGGCCTTTTTATGG - Intronic
1097663739 12:62457664-62457686 CATTCTTCAAAAACATTTAAAGG - Intergenic
1099611012 12:84869889-84869911 TATCCTTTATAGCCCTTAAATGG + Intronic
1100935531 12:99661032-99661054 CATGCTTCAAGGCCCTGGAAAGG - Intronic
1101380871 12:104212879-104212901 CATCCTGCTAAGTCCTTTACTGG - Intergenic
1102909954 12:116705727-116705749 CATCCTTCAAAGCCCTTTAAGGG + Intergenic
1106931156 13:34667286-34667308 CATCCTAGACAGCCCTTCAAGGG + Intergenic
1107019163 13:35733866-35733888 CATTTTCCAAAGTCCTTTAAAGG - Intergenic
1107114189 13:36728722-36728744 CTTTGTTCAAAGGCCTTTAATGG - Intergenic
1107588301 13:41876255-41876277 CATTCCTCAAAACCCTCTAATGG + Intronic
1111286204 13:86095716-86095738 AATCCTTCACAGACCTCTAACGG + Intergenic
1114828399 14:26108240-26108262 CTTCCTTCAGAGCTCTTTTAGGG - Intergenic
1115484515 14:33897653-33897675 CAACCTTCAAAGTCCTTCCATGG + Intergenic
1116974472 14:51100301-51100323 TATCTTTCAAATCCCTTTTATGG - Intergenic
1117674941 14:58145937-58145959 CATCTTTCAAAGCCCAGTATAGG + Intronic
1118358122 14:65032282-65032304 CTTCTTTCAAAGACCTATAATGG - Intronic
1118435186 14:65764806-65764828 CATCATTAAAAGGCCATTAAAGG - Intergenic
1118853962 14:69606710-69606732 CAGCTTTCAAAGCCCTGTGAAGG - Intergenic
1119132851 14:72190604-72190626 CATCCCTGAAAGCCCCATAAGGG - Intronic
1121102773 14:91261486-91261508 CATCCTTCAAGGCCCTGCCAGGG - Intergenic
1121819356 14:96953831-96953853 CCTCCTTAAAAGTCTTTTAATGG + Intergenic
1125092323 15:35808840-35808862 CATCCTTCAAAAGTCTTTATAGG - Intergenic
1125661277 15:41396762-41396784 CATCCTTCAAAAGCCTAAAATGG + Exonic
1129537853 15:76328875-76328897 CATCCTTAAAAGCCTTTAAAAGG + Intergenic
1130428597 15:83823755-83823777 CATTCCTCAAAGCCCTTCAATGG + Intronic
1131704742 15:94981247-94981269 TATCCCTCAAAGCTTTTTAAAGG + Intergenic
1133890401 16:9874000-9874022 CATTCTACAACTCCCTTTAAGGG + Intronic
1134312715 16:13090963-13090985 CTTCCTTCAAAACCCTTGTAAGG + Intronic
1140814863 16:78612249-78612271 CATCCTTCACAAACCTTCAAGGG - Intronic
1141288708 16:82697380-82697402 CATCCTTTAATCACCTTTAAGGG + Intronic
1142862237 17:2769638-2769660 CATCCTTTAAGCCCCTTTACAGG - Intergenic
1143345705 17:6247306-6247328 CATCCTTCATAGCCCTCAGACGG - Intergenic
1144441590 17:15287389-15287411 CATCCTTTAATGCCCCTTCATGG + Intergenic
1147453237 17:40519125-40519147 GATCCCTCAGAGCCCTTTGAGGG - Intergenic
1149884035 17:60322780-60322802 CATTCTTCAAAGCACTAAAATGG + Intronic
1150424411 17:65066100-65066122 CTTCTTTAAAAGCCCTTTGAAGG + Intergenic
1150801761 17:68288718-68288740 AATCCTTCTAAGCCCTTTGAAGG + Intronic
1152719629 17:81916923-81916945 CATCCTTCAAGGCCCAATCAAGG + Intronic
1153304299 18:3618250-3618272 CTCTCTTCAAAGCCCCTTAAAGG - Intronic
1155283973 18:24270467-24270489 CCTCTTTAAAAACCCTTTAAAGG - Intronic
1156223062 18:35073828-35073850 CATTTTTAAAAGCTCTTTAAAGG + Intronic
1157421120 18:47548378-47548400 CATCATCCAAAGCACTTTACAGG + Intergenic
1160014317 18:75128818-75128840 AATCATTGAAAGTCCTTTAATGG + Intergenic
1163678207 19:18666005-18666027 CAGCCAGCAATGCCCTTTAAAGG + Intronic
1168438564 19:56343122-56343144 CATCCTTCAAATGCCTAAAATGG + Intronic
928440625 2:31289116-31289138 CATCCTTCAAGGCCCAGGAAAGG + Intergenic
930245896 2:48983060-48983082 TATTCTTCAAGGCCATTTAAAGG - Intronic
930381773 2:50638871-50638893 AATTTTTCAAAGCCCTTGAATGG - Intronic
932531801 2:72542119-72542141 CATACTTCATAGCCTTTTACAGG + Intronic
935321450 2:101893402-101893424 CCTACCTCAAATCCCTTTAAAGG - Intronic
935685444 2:105678809-105678831 CCTCCCTCAAACCCCTATAAAGG - Intergenic
939192842 2:138936846-138936868 CATATTTCAAATCCATTTAATGG + Intergenic
939403498 2:141726880-141726902 CATCCTTCAAAATCCTTTCAAGG - Intronic
939622524 2:144437813-144437835 CAACTTTCAAAGCCCATAAAAGG + Intronic
940288522 2:152055698-152055720 CAGCCTTCAAAGCTATTTTAAGG - Intronic
942418097 2:175779861-175779883 CTTCCTTTAAAAGCCTTTAAAGG + Intergenic
942418098 2:175779864-175779886 CTTCCTTTAAAGGCTTTTAAAGG - Intergenic
944534615 2:200696695-200696717 CCCCATTCAAAGTCCTTTAATGG - Intergenic
944565496 2:200986137-200986159 CATCTTTCAGAGCCATTTAAAGG + Intronic
944861877 2:203822907-203822929 CTTCATCCAAATCCCTTTAAGGG + Intergenic
1171106712 20:22440501-22440523 CATCCTTCAAAACCCATCACAGG - Intergenic
1171541811 20:25964736-25964758 CATCTGTCAAAGCCCATAAATGG + Intergenic
1171980893 20:31628007-31628029 CCTCCCTCACAGCCCTTAAAAGG + Intergenic
1172584665 20:36074456-36074478 CAATCTTCAAAGCCCTTTGCAGG - Intergenic
1172660209 20:36562894-36562916 CCTCCTGCAGAGCCATTTAATGG - Intergenic
1173217860 20:41103429-41103451 CACTGTTCAAAGTCCTTTAAGGG - Intronic
1173217925 20:41104039-41104061 CACTGTTCAAAGTCCTTTAAGGG + Intronic
1174174906 20:48638488-48638510 CATCTTTCTAAGCCCTTTTGTGG - Intronic
1174699017 20:52589191-52589213 GATACTTCAAAGCCTTTTCAGGG - Intergenic
1175413279 20:58785341-58785363 CCTCCTCCAAAGCCCTCTCATGG + Intergenic
1177286181 21:19053789-19053811 CAAACTTCAATGCTCTTTAAAGG - Intergenic
1178272218 21:31201443-31201465 TTTCCTTAAAAGCCCTTAAAGGG + Intronic
1185306988 22:50124651-50124673 CATCCTGCAAAACCCATTGAGGG - Intronic
949276210 3:2285230-2285252 CATCCTTAAAAGCCCATTTAAGG + Intronic
952565194 3:34648556-34648578 TATACTTCAGAGCTCTTTAATGG - Intergenic
957188487 3:76974794-76974816 TATCCCACAAAGCCCTCTAAGGG - Intronic
958516817 3:95126940-95126962 CATGCTTCAAGGCCCAGTAAAGG + Intergenic
961854345 3:129854431-129854453 CTTGCTTAAAAACCCTTTAATGG + Intronic
963961600 3:151315085-151315107 AATCCCTCAAAGCCCAATAAAGG - Intronic
967279937 3:187812178-187812200 CATCCTGAAAAGCCCTTCTATGG - Intergenic
968226803 3:196977492-196977514 TATCCTTCAAATCCTTTGAATGG - Intergenic
969856147 4:10001419-10001441 CTTCCTTCAAAGCCCTCAGAAGG + Intronic
970319835 4:14864148-14864170 CATTCTTCCAAGCACTTTACAGG + Intergenic
970934344 4:21550936-21550958 CATCCTTTAAAACGCTTTAGAGG + Intronic
970989376 4:22194715-22194737 CATCCTTCAAGGCCCAGGAAAGG - Intergenic
971955194 4:33408364-33408386 CCACCCTCCAAGCCCTTTAATGG + Intergenic
975310877 4:72902412-72902434 CATTCTTAAGAGCCCTATAAAGG - Intergenic
975994724 4:80301308-80301330 CAAACTTCAGACCCCTTTAAAGG + Intronic
976304296 4:83544242-83544264 CATGCTTCACAGCCTTTTCAAGG + Intronic
978613277 4:110567723-110567745 TATCCCTCAAGGCCTTTTAATGG + Intergenic
978827326 4:113041205-113041227 AAGCCATCAAAGCCATTTAATGG - Intronic
980996620 4:139785380-139785402 CCTCCTTCACAGCCCTTCCAGGG - Intronic
983575003 4:169251578-169251600 CGTCCTTCAAAAGCTTTTAATGG + Intronic
986294524 5:6426664-6426686 CATCTGTCAAAGCCCCTTAGAGG - Intergenic
986740529 5:10701460-10701482 CATCCTTGAAAACCATTTTAGGG - Intronic
989100819 5:37821345-37821367 CATTCTGCCAAGCCTTTTAAAGG - Intronic
989619305 5:43368821-43368843 CCTCCTTCACAGCCCTTAGAAGG + Intergenic
992661403 5:78964904-78964926 AATCCTTCAAAGCTATATAATGG + Intronic
994197813 5:96938728-96938750 CATCCTTATAAGCCCTTTCCAGG - Intronic
995530639 5:113088702-113088724 TCTCTTTCAAAGCCCTTTGAGGG + Intronic
997186415 5:131886026-131886048 AATCCATCAGAGCCTTTTAATGG + Intronic
999299897 5:150484935-150484957 CATCCTTACAAGCTCCTTAAGGG + Intergenic
1002614761 5:180444455-180444477 AATAATTCAAAGCCCTTTCATGG - Intergenic
1003285279 6:4728753-4728775 CATCCTTCAAAGCGATGTCATGG + Intronic
1005324945 6:24690865-24690887 TATCCTTCAAAGTCCTTTGCAGG + Intronic
1008439883 6:51520757-51520779 CTTCATTCAGAGGCCTTTAATGG - Intergenic
1008640073 6:53453422-53453444 CCTCCTGCAAACCCTTTTAATGG - Intergenic
1010278101 6:73991994-73992016 CATTCTCAAAAGCCCTGTAAAGG + Intergenic
1010850716 6:80773088-80773110 CCTGCTTCAAAGCTCTTTCATGG - Intergenic
1012437786 6:99233577-99233599 CATCCTTCATTCCCCTTTATAGG - Intergenic
1013013269 6:106138740-106138762 CAACATTCTAAGCCCTTTAGGGG - Intergenic
1013186121 6:107759998-107760020 CATCTTCCAAAGCCTTTAAATGG + Intronic
1014849642 6:126326127-126326149 CATCCTTTGAGGCCCTTGAAGGG - Intergenic
1015061432 6:128971507-128971529 CATCCTCCAAACCCCTGTACAGG - Intronic
1015396014 6:132735704-132735726 CATCCTTATAAGTCCCTTAAGGG + Intergenic
1016896324 6:149056935-149056957 CTTCATTCACAGCCCTTCAAGGG + Intronic
1017464328 6:154680400-154680422 TATCCTTCAGAGGCCTTTGATGG - Intergenic
1018304770 6:162443511-162443533 CATCACTCGAAGCCCTTAAATGG + Intronic
1019196453 6:170286028-170286050 CATTCGTCTAAGCCCCTTAACGG - Intronic
1023612758 7:41988071-41988093 CATTCTTCAAAGTGCCTTAAGGG + Intronic
1024308043 7:47944595-47944617 CTTCCTTCAAAGCTCTCTACAGG + Intronic
1030727888 7:112947761-112947783 CATCCTTACAAGCCATTTTATGG + Intergenic
1031307071 7:120142149-120142171 CATTTTTCCAAGCCCTTAAAAGG - Intergenic
1032937892 7:136755078-136755100 CAGCTTTCAAAGCCTTTGAAGGG + Intergenic
1033666001 7:143441266-143441288 CTGCCTTCAAAGCACTTTTATGG - Intergenic
1033972493 7:147059269-147059291 CATCCTCCAAACCAATTTAATGG - Intronic
1035461823 7:159044129-159044151 CAGCCTACAAAGGCCTTTAGAGG + Intronic
1035684118 8:1510453-1510475 CATCCTTGACAGCACTTTCACGG - Intronic
1037070703 8:14644532-14644554 TCTCCTTCAAAGTCCATTAATGG + Intronic
1040696945 8:50011302-50011324 CATCCTTCAAGAATCTTTAACGG - Intronic
1042009969 8:64233186-64233208 TATCCTTCCAAGCCCTTTTATGG + Intergenic
1048210877 8:132453281-132453303 CATGGTTCAAAGCCCTTCAGGGG - Intronic
1050443848 9:5696824-5696846 CAACCTTCAATACTCTTTAAAGG - Intronic
1051954735 9:22678203-22678225 CCTACTTCAAAACCCTGTAATGG + Intergenic
1055371495 9:75604417-75604439 CATGCGTCAAAGCTCTGTAAGGG + Intergenic
1055686719 9:78782897-78782919 CATCCATCAACCCCCTTTATGGG - Intergenic
1056126976 9:83543966-83543988 CATCCTTAATAGCCCTGGAATGG - Intergenic
1057913405 9:99037179-99037201 CATCCTTCAAACCCCCATCATGG + Intronic
1058750010 9:108030750-108030772 CTTCCTTCAGAGCTCTTTTAGGG + Intergenic
1186933787 X:14424594-14424616 CATTCTTTAAAACCCTTTTATGG + Intergenic
1187437645 X:19287389-19287411 CTTCCTTCAAAGCCCATGATGGG - Intergenic
1190752926 X:53377692-53377714 GATCATTCACAGCCCTTTAAAGG - Exonic
1192425737 X:71074538-71074560 CATCCTTCAAAGCCCAGTGCAGG + Intergenic
1198107535 X:133475783-133475805 CAGCCTGCAAAGCCCTTCAGTGG - Intergenic
1199905378 X:152223466-152223488 TATAATTCAAAGACCTTTAATGG + Intronic