ID: 1102909956

View in Genome Browser
Species Human (GRCh38)
Location 12:116705735-116705757
Sequence AAAGCCCTTTAAGGGATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102909951_1102909956 19 Left 1102909951 12:116705693-116705715 CCGCAGTGGCGTGCAACTCACTT 0: 1
1: 0
2: 2
3: 5
4: 81
Right 1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG 0: 1
1: 0
2: 0
3: 8
4: 157
1102909950_1102909956 25 Left 1102909950 12:116705687-116705709 CCAACTCCGCAGTGGCGTGCAAC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG 0: 1
1: 0
2: 0
3: 8
4: 157
1102909952_1102909956 -9 Left 1102909952 12:116705721-116705743 CCAACTCATCCTTCAAAGCCCTT 0: 2
1: 2
2: 35
3: 160
4: 696
Right 1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG 0: 1
1: 0
2: 0
3: 8
4: 157
1102909949_1102909956 26 Left 1102909949 12:116705686-116705708 CCCAACTCCGCAGTGGCGTGCAA 0: 1
1: 0
2: 0
3: 7
4: 42
Right 1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102909956 Original CRISPR AAAGCCCTTTAAGGGATATT TGG Intergenic
911693534 1:100862348-100862370 CAAGCCCCATAAGGGACATTTGG - Intergenic
913462502 1:119102660-119102682 AAAGTTCTTAAAGGAATATTTGG - Intronic
915821815 1:159031768-159031790 AAAGCCTATTAAGATATATTAGG + Intronic
916269121 1:162920922-162920944 AAAGACTTTTAAGGGATTCTTGG + Intergenic
917382282 1:174425808-174425830 AAAGACATTCCAGGGATATTGGG + Intronic
919714762 1:200764734-200764756 ATTGCCATTTACGGGATATTTGG - Intronic
1065541752 10:26777113-26777135 AGCGCCCTGTAAGGTATATTCGG - Exonic
1066791817 10:39073469-39073491 AAAGCCCATTGAGGGCTATGGGG + Intergenic
1066796078 10:39122510-39122532 GAAGCCCTTTGAGGCATATGGGG + Intergenic
1067118524 10:43454955-43454977 AAAGTCCTTTAAGGGATACGAGG + Intronic
1069440871 10:68426943-68426965 CTAGCCCTTTAATGGATATGTGG - Intronic
1070484614 10:76917892-76917914 AAAGCCATTTAAGGAATCTGGGG - Intronic
1074791680 10:116895373-116895395 ACAGCCCTTTATTGGACATTTGG + Intronic
1078557630 11:12343072-12343094 AAAGCACTTTGGGGGATCTTCGG - Intronic
1079438541 11:20484191-20484213 ACTGCCCTTAAAGGGCTATTGGG + Intronic
1081766834 11:45617142-45617164 AAAGCCCCTTAAGGGATCATGGG - Intergenic
1082146412 11:48675736-48675758 AGAGTCCGTGAAGGGATATTAGG + Intergenic
1082149481 11:48717342-48717364 AAAACCTGTAAAGGGATATTGGG - Intergenic
1082589259 11:54985524-54985546 AGAATCCATTAAGGGATATTAGG + Intergenic
1083912648 11:65719262-65719284 AAAGCACTCTAAGGGAGATGGGG + Exonic
1084307779 11:68298119-68298141 TAAGACCTTGAAGGGCTATTAGG + Intergenic
1085363054 11:75910192-75910214 ACAGACATTTAAAGGATATTAGG - Intronic
1087106586 11:94415487-94415509 AAAGAGGTTTAATGGATATTAGG - Intergenic
1087913878 11:103785398-103785420 AATCCCCTTTAAGTGATCTTAGG + Intergenic
1091993059 12:4972497-4972519 AAAGCCCTGTAAGAGATCCTGGG + Intergenic
1096347318 12:50861080-50861102 AACTCCCTTTTAGGAATATTGGG - Intronic
1097347775 12:58513675-58513697 AAAGGGCTATAAGGCATATTAGG - Intergenic
1097658710 12:62402645-62402667 AAAGCTCTTAAAGGGACATGGGG + Intronic
1100670489 12:96806822-96806844 AAAGCTGTTTAAGGGAGATAGGG + Intronic
1102909956 12:116705735-116705757 AAAGCCCTTTAAGGGATATTTGG + Intergenic
1105628548 13:22137711-22137733 AAAGGCTTATAAGGGTTATTTGG - Intergenic
1106224545 13:27775035-27775057 GAAGCCCTTTGTAGGATATTTGG + Intergenic
1108085101 13:46779958-46779980 AAAAGCCTTTAGTGGATATTTGG - Exonic
1108209990 13:48128462-48128484 TAAGCCCTCTACGGGATATTAGG + Intergenic
1109641598 13:65198926-65198948 AAAGCCCTATTTGGGGTATTTGG + Intergenic
1110130595 13:72004128-72004150 AAAGCCTATTTAGGGAAATTGGG + Intergenic
1112158113 13:96839618-96839640 AAAACACTTTAAGGGATTTATGG + Intergenic
1116445702 14:45008003-45008025 AAAACCCTTTAATGGATTTAGGG - Intronic
1118553800 14:66989785-66989807 AAGGCACTTTAAGGTATACTTGG - Intronic
1119108192 14:71944271-71944293 AAAGTCCTTTAAGAGATGTTGGG + Intronic
1119238548 14:73039991-73040013 GAATCCCTTAAAGGGATATCAGG + Intergenic
1120675096 14:87412777-87412799 TAATTCCTTTAAGGGGTATTAGG + Intergenic
1122157762 14:99760653-99760675 AAAGCCCTTTCAGGGAGAAAGGG - Intronic
1130092124 15:80829791-80829813 AAATACCTTTAAGGAGTATTGGG + Intronic
1131384456 15:91992034-91992056 AAAGTCCCTTAAGGGATTATTGG - Intronic
1132176295 15:99717954-99717976 AAAGCCCGCTGAGGGATATGTGG - Intronic
1136739039 16:32496144-32496166 AAAACCTGTGAAGGGATATTTGG + Intergenic
1137059406 16:35774486-35774508 AAAGCCCTTTGAGGCCTATAGGG - Intergenic
1139480382 16:67227295-67227317 AAAGAACATTAAGGGATATGGGG + Intronic
1142366872 16:89655027-89655049 AAAGCCCTTTCAGGAATCTGGGG - Intronic
1203014175 16_KI270728v1_random:335648-335670 AAAACCTGTGAAGGGATATTTGG - Intergenic
1203032510 16_KI270728v1_random:608807-608829 AAAACCTGTGAAGGGATATTTGG - Intergenic
1142530039 17:573319-573341 AAAGCCATTTAAAGGATGTAAGG + Intronic
1143941074 17:10541903-10541925 AGAGGCGTTTAAAGGATATTAGG + Intronic
1144533613 17:16064788-16064810 ATAGCCTTTTAAGGTATCTTGGG - Intronic
1144800892 17:17926283-17926305 AATGCCTTTTGAGAGATATTGGG - Intronic
1146589405 17:34115670-34115692 AAAGCCATATGAGGAATATTTGG - Intronic
1147114736 17:38290511-38290533 ATAGCCCTGAAAGGGATATAAGG - Intergenic
1148414878 17:47498694-47498716 ATAGCCCTGAAAGGGATATAAGG + Intergenic
1149188347 17:54029021-54029043 AATGCCCTTTAAGTCATAGTGGG + Intergenic
1149259833 17:54867103-54867125 AAGGTCCTGTAAGGGATACTGGG + Intergenic
1155833396 18:30546359-30546381 ATAGTCCTTTCAGGGAGATTTGG + Intergenic
1156802647 18:41136545-41136567 AAAACCACTTTAGGGATATTAGG - Intergenic
1157160097 18:45306122-45306144 GAAGCCCATTATGAGATATTGGG + Intronic
1157522419 18:48354544-48354566 GATGCCCCTTAAGGCATATTTGG - Intronic
1157529912 18:48411028-48411050 AAATCCCAATAAGTGATATTAGG - Intergenic
1158862622 18:61607344-61607366 AAAACCCTTTAAGGGATGCAAGG + Intergenic
1161669112 19:5594828-5594850 AAAGCCCTTTACAGTATATGGGG - Intronic
1164334162 19:24293839-24293861 AAAATCATTGAAGGGATATTTGG + Intergenic
1164805735 19:31115231-31115253 AAACCTCTTTAAGGAATATAAGG + Intergenic
1164824447 19:31274093-31274115 TAAGCCCTTTCAGAGATGTTCGG - Intergenic
925941823 2:8828036-8828058 AAAGCCCTCTAAGGGCTTCTCGG + Intronic
927059590 2:19403641-19403663 AATGCTATTAAAGGGATATTTGG - Intergenic
927108765 2:19849459-19849481 AGAGCCCTTTAAGGGATGCTGGG + Intergenic
931458544 2:62431483-62431505 AAAGCCCTGGAAGAGATATGGGG - Intergenic
931622809 2:64228309-64228331 AAAGCCCCTGAAGGGATTTGAGG - Intergenic
931664960 2:64603765-64603787 AAAGACATTTTAGGGACATTTGG - Intergenic
933511969 2:83251591-83251613 AATGCCTGTTAATGGATATTAGG + Intergenic
938705073 2:133916742-133916764 AAAACCATTTAATGGATATAAGG - Intergenic
940358787 2:152774529-152774551 AAAGCCCTAGAAGTGAAATTAGG - Intergenic
940768507 2:157815989-157816011 ATAGCCATTTAAGGGACACTAGG + Intronic
941149778 2:161900075-161900097 AAAGCACTTCAAAGGATAATAGG - Intronic
942881025 2:180860508-180860530 AATGTCCTTTAAGGGACATTTGG - Intergenic
944106182 2:196082181-196082203 CCAGGCCTTTAAGGGATATCTGG - Intergenic
944610188 2:201395968-201395990 ATACCCCTTTCAGGGATATGTGG + Intronic
946514589 2:220397806-220397828 AGAGCCCATTAAGTGCTATTTGG - Intergenic
948179037 2:235965762-235965784 ATAACCCTTTAAGGAATAATGGG + Intronic
949061412 2:241960217-241960239 AGAGCCCATTAAGGAATAGTGGG - Intergenic
1173222991 20:41144641-41144663 AAAGCCCTTCTCAGGATATTTGG - Intronic
1175680542 20:60985191-60985213 AATGCCTTTCAAGGGATACTTGG + Intergenic
1179523900 21:41963003-41963025 AATTCCCTTTAAAGGATCTTTGG - Intergenic
1184549010 22:45194374-45194396 AACCCCCTTTAAGACATATTGGG - Intronic
952129248 3:30340788-30340810 ATAGCACTTTAAGGAATGTTTGG + Intergenic
957089044 3:75709966-75709988 AAAATCCTTTTAGGCATATTTGG + Intronic
957415936 3:79904977-79904999 GAAGGCCTTTAAGGGAACTTGGG - Intergenic
957841719 3:85679498-85679520 AGAGCACTTTAAACGATATTGGG + Intronic
959409631 3:106004580-106004602 AAAGCCCTTCCAGAGATATGAGG + Intergenic
960532469 3:118780444-118780466 ATAGCCCTTGAAGGGAGATATGG - Intergenic
964815289 3:160710747-160710769 AAAGCCCTCTCTGGGATCTTTGG - Intergenic
966364690 3:179172399-179172421 AAAGAAATTTAAAGGATATTTGG + Intronic
967163097 3:186756806-186756828 AAACCTCTTTATGGGATACTAGG + Intergenic
967599220 3:191364487-191364509 AAATCTCTTTAAGAGATTTTTGG + Intronic
970907351 4:21231214-21231236 ATAGCCCTTTAAGAGAATTTTGG - Intronic
971298241 4:25419928-25419950 AAAGAGCTTTAATGGATTTTAGG + Intergenic
971531630 4:27695991-27696013 AAAGCACTTTAAGCGCTATCAGG - Intergenic
972774201 4:42226480-42226502 AAAGCAGAATAAGGGATATTTGG - Intergenic
972907052 4:43763299-43763321 AAAGAGCTTTAAGTGAGATTTGG + Intergenic
974331345 4:60483067-60483089 AAAGCAATTTAAGGATTATTAGG + Intergenic
975814587 4:78204537-78204559 AAAGAGATTTAAGGGCTATTTGG + Intronic
976905008 4:90226454-90226476 AAAGAAATTTAAGGGATATGGGG + Intronic
977349261 4:95860026-95860048 AAATCCCTTGAAAGGATCTTGGG + Intergenic
980401622 4:132294664-132294686 ACATCCCTTTCTGGGATATTGGG - Intergenic
980446032 4:132908886-132908908 AAAGCCCTTTTGGGGAAACTAGG + Intergenic
981801562 4:148663781-148663803 AAAGCAATTTATGGTATATTTGG + Intergenic
987337014 5:16906089-16906111 AAGGCCTGTTAAGGGATATGGGG - Intronic
988174936 5:27710521-27710543 AAAGCCTTTTGAGGCATTTTTGG - Intergenic
988902913 5:35753285-35753307 AAAGCCCTTTCAGTGAATTTTGG - Intronic
989258997 5:39398199-39398221 AAAGCACTTTGAGGGGTTTTGGG + Intronic
989852270 5:46228769-46228791 AGAGACTTTGAAGGGATATTTGG + Intergenic
990534113 5:56703348-56703370 ATAGCCCTTTAGGGGAAAGTCGG - Intergenic
990687251 5:58319050-58319072 AAAACATTTTAAGGGATATGAGG + Intergenic
990696271 5:58421019-58421041 AAAGTCCTGTAAGGGACACTGGG + Intergenic
991313826 5:65277021-65277043 AAGGCTCTGTAAGGGAAATTTGG + Intronic
993653929 5:90555361-90555383 AAAGCCTTTAAAGGCAGATTCGG + Intronic
995383400 5:111562068-111562090 AAAGTCTTTTGAGGGAAATTAGG - Intergenic
995549463 5:113266462-113266484 AAAGCCCTATGTGAGATATTGGG - Intronic
998490062 5:142539116-142539138 AAAACCCTATAATGGACATTGGG + Intergenic
999408597 5:151329228-151329250 AAAGCCCATGAAGTGATATTTGG - Intronic
1005571595 6:27150538-27150560 AAACACCTATAAGAGATATTTGG + Intergenic
1005789313 6:29280431-29280453 TAAGGCCTTTAAGTGATCTTAGG + Intergenic
1008061269 6:46999439-46999461 GAAGCCAGTTAAGGGAAATTGGG - Exonic
1009262915 6:61518317-61518339 ATAGTCTTTGAAGGGATATTTGG + Intergenic
1010289336 6:74116927-74116949 AAAGACCTTCAAGGGATTTGAGG - Intergenic
1011739119 6:90341927-90341949 AAAGCCCTTTAGGAGCTACTTGG + Intergenic
1012599732 6:101080266-101080288 ATAGTCCTTTGGGGGATATTTGG + Intergenic
1016674077 6:146743314-146743336 AGAGACCTTTAAAGAATATTTGG + Intronic
1020006541 7:4786416-4786438 CAACCTCTTTAAGGTATATTTGG + Exonic
1020518293 7:9153638-9153660 AAAGTATTTTAAGGGAAATTTGG - Intergenic
1021053276 7:16015740-16015762 AAAGCAGCTTAAGGGCTATTAGG - Intergenic
1023129919 7:36992388-36992410 AAAGCCTTCAAAGGGATAGTTGG + Intronic
1025590339 7:62851590-62851612 AAAATCCGTGAAGGGATATTTGG + Intergenic
1025595461 7:62918662-62918684 AGAGTCCTCAAAGGGATATTAGG + Intergenic
1032674643 7:134118017-134118039 AAGGATCTTGAAGGGATATTTGG + Intergenic
1033216439 7:139496596-139496618 CATGGCCTTTAAGGGAGATTGGG + Intergenic
1033372644 7:140725038-140725060 AGAGCAATTTTAGGGATATTAGG - Intronic
1033515815 7:142105006-142105028 AAAGTCCTTTATGGTATAGTTGG - Intronic
1033851810 7:145505417-145505439 AAAGTCTTTTCAGTGATATTTGG - Intergenic
1033984168 7:147202527-147202549 AATGTCCTCTAAGAGATATTAGG + Intronic
1038111544 8:24505297-24505319 AAAGCCCTTAAAGGAAGCTTAGG - Intronic
1041574077 8:59372994-59373016 AAAGCAGATTGAGGGATATTTGG - Intergenic
1041617472 8:59924784-59924806 AAAGCCATTTGAGGGATATAAGG + Intergenic
1044063087 8:87663623-87663645 ATAGCCCTTTAGGTGAGATTAGG + Intergenic
1048066425 8:130974137-130974159 AAAACCCATCAAGGGATAATGGG - Intronic
1053409482 9:37906312-37906334 AAGGACCTTGAAGGGCTATTTGG - Intronic
1055575979 9:77660626-77660648 AACGCCCCTCAGGGGATATTCGG + Intergenic
1055603084 9:77940214-77940236 TATGCACTATAAGGGATATTAGG - Intronic
1056255597 9:84795820-84795842 ATGGCCCTTTAAGGGAGGTTTGG + Intronic
1056542756 9:87587993-87588015 ACAGCCCTTTAAGGAAGATATGG + Intronic
1057992634 9:99786612-99786634 AATCCCTTTTGAGGGATATTTGG - Intergenic
1060721477 9:125982469-125982491 ACAGCCTTTTAGGGGAGATTTGG - Intergenic
1061623354 9:131825605-131825627 AAGGCCCTGTCAGGGAGATTGGG - Intergenic
1062416934 9:136455905-136455927 AAAGCCCTTTCTGGGGAATTAGG + Intronic
1186101697 X:6164283-6164305 AAAGCCTTTTAAAGGAAATGAGG - Intronic
1188046927 X:25436294-25436316 AAAGCCATTTATGGAATACTTGG - Intergenic
1190788600 X:53678505-53678527 AAAGTCCTTTAAGGACTTTTAGG - Intronic
1197024782 X:121736157-121736179 AAAGTCTTTTAAGACATATTTGG + Intergenic