ID: 1102910375

View in Genome Browser
Species Human (GRCh38)
Location 12:116709021-116709043
Sequence GAGAGCTCCACGCAGGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102910369_1102910375 26 Left 1102910369 12:116708972-116708994 CCACCAGATGGTTCTCATCTATA 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 135
1102910368_1102910375 27 Left 1102910368 12:116708971-116708993 CCCACCAGATGGTTCTCATCTAT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 135
1102910370_1102910375 23 Left 1102910370 12:116708975-116708997 CCAGATGGTTCTCATCTATAGAA 0: 1
1: 0
2: 2
3: 17
4: 214
Right 1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 135
1102910367_1102910375 28 Left 1102910367 12:116708970-116708992 CCCCACCAGATGGTTCTCATCTA 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG 0: 1
1: 0
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102910375 Original CRISPR GAGAGCTCCACGCAGGCACG GGG Intergenic
900513276 1:3070113-3070135 GAGGGGTCCACGCGGGCCCGAGG - Intronic
900582414 1:3415665-3415687 GAGAGGCCCACCCAGGCCCGAGG + Intronic
904378187 1:30094831-30094853 CTGAGATCCACGCAGGCACCAGG - Intergenic
907240596 1:53078990-53079012 GCGAGGTCCACCCAGGCACGGGG - Exonic
908009306 1:59759347-59759369 GGGAGCTCCATGCAGGAAGGTGG + Intronic
911017122 1:93345677-93345699 GAGAGCTCCAAGCACGCGCTTGG - Intergenic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
912899260 1:113630424-113630446 TAGAGCACCACGCAGGCTCTCGG - Intronic
914674819 1:149900263-149900285 GAGAGCTCACCACAGCCACGCGG - Exonic
920565185 1:206967409-206967431 CAGAGCTCCAGGCTGGCAAGTGG - Intronic
920663306 1:207938202-207938224 GAGAGCTCCACTCAGCAAAGTGG + Intergenic
922388540 1:225113947-225113969 TAGAGCACCAAGCAGGCACTTGG - Intronic
1064814800 10:19247921-19247943 GAGAGCTCCACCCAGTAACATGG + Intronic
1065381526 10:25095987-25096009 TAGAGCACCAAGCAGGCACTTGG - Intergenic
1067721266 10:48729361-48729383 GAGAGCACCATGCACGCATGTGG + Intronic
1067765363 10:49081760-49081782 GGGAGCCACACGCAGGCAGGAGG - Intronic
1071292502 10:84197710-84197732 GAGAGCTCCATCCAGCCACAGGG + Intronic
1072584890 10:96772793-96772815 GAGTGCCCCAGGCAGCCACGTGG + Intergenic
1077074030 11:691955-691977 GAGAGCTCCTCGTAGGCATAGGG - Intronic
1077500873 11:2909318-2909340 GAGCGCTCCGGGCAGGCGCGAGG - Exonic
1080839343 11:35969817-35969839 AAAAACTCCACGCATGCACGTGG - Intronic
1083970290 11:66070339-66070361 GCGAGCTGCACGCACGCGCGGGG - Intergenic
1089268705 11:117286075-117286097 GTGAGCTCCAGACAGGCACTGGG + Exonic
1090606189 11:128425024-128425046 GAGAGCTCCACTGAGGCCTGTGG - Intergenic
1092290868 12:7158787-7158809 GTGAGCTGCACGCAGGAACATGG - Exonic
1096088772 12:48884144-48884166 GAGAGCTGCACGCAGGTTCAGGG + Intergenic
1102588608 12:113940653-113940675 CAGAGCTCCAGGCAGCCACAGGG + Intronic
1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG + Intergenic
1104618908 12:130294741-130294763 GAGAGCTCCACCCAAGCCAGAGG + Intergenic
1105845527 13:24290694-24290716 GCGAGCTCCAGGCAGGCGCCCGG - Exonic
1106892482 13:34261030-34261052 GAGAGCTCCACACAGCAATGTGG + Intergenic
1106893038 13:34267083-34267105 GAGAGCTCCACCCCAGCATGTGG + Intergenic
1107507707 13:41051271-41051293 TGGAGCTCCAAGCAGGCAGGTGG - Intronic
1113384821 13:109839120-109839142 GGCAGCTGCACGCAGCCACGTGG + Intergenic
1116040539 14:39681044-39681066 GAGAGCTCCACCCAGCAATGGGG - Intergenic
1120682252 14:87494284-87494306 GAGAGCTCCACCCAGCAACATGG - Intergenic
1121840503 14:97130023-97130045 GAGTGCTCCAAAGAGGCACGGGG - Intergenic
1122193925 14:100070517-100070539 GAGATACGCACGCAGGCACGGGG - Intronic
1123064624 14:105611257-105611279 GAGGGCTCCATGCTGGCAGGAGG - Intergenic
1123073928 14:105656898-105656920 GAGGGCTCCATGCTGGCAGGAGG - Intergenic
1123087928 14:105726481-105726503 GAGGGCTCCATGCTGGCAGGAGG - Intergenic
1123093886 14:105755854-105755876 GAGGGCTCCATGCTGGCAGGAGG - Intergenic
1123711332 15:22989954-22989976 GAGAGATCCAGGCGGGCACCAGG - Intronic
1123964236 15:25439076-25439098 GAGGGCTCCAGGCCGGGACGCGG + Intergenic
1124116563 15:26848769-26848791 GAGAGCTCCACCCAGCAACATGG - Intronic
1131066163 15:89436128-89436150 GAGTGCTCACAGCAGGCACGAGG - Intergenic
1131738774 15:95363797-95363819 GAGAGCTTCACGCTGACACTCGG + Intergenic
1134226512 16:12395241-12395263 CAGAGTTCCACGCTGGCACTGGG + Intronic
1138234208 16:55367047-55367069 CAGAGCTCCAGGAAGCCACGAGG - Intergenic
1141592018 16:85075669-85075691 GAGAACTACACGTAGGCACACGG - Intronic
1141747238 16:85933942-85933964 AAGAGCCCCACACAAGCACGTGG - Intergenic
1141747479 16:85935457-85935479 GACAGCTCCAAGCAGGAAAGGGG + Intergenic
1143923979 17:10353180-10353202 GAGAGCTCCACCCAGCAACATGG - Intronic
1145267968 17:21389621-21389643 GAGACCTCCACTCAGCCATGGGG - Intronic
1149216988 17:54369185-54369207 GAGAGCTCCACCCAGCAACATGG - Intergenic
1150263914 17:63819605-63819627 GAGACCTTCAGGCAGGCAGGAGG + Exonic
1152190484 17:78884738-78884760 GAGATCTCCAAGAAGACACGGGG - Intronic
1152571400 17:81122816-81122838 GGGACCTCCTCGCAGGTACGAGG - Exonic
1153796363 18:8626546-8626568 CAGAGCTCCAGGGAGGCACCAGG - Intronic
1155229281 18:23757359-23757381 GAGAGCGCCAAGCAGGCTGGAGG - Intronic
1156073013 18:33236781-33236803 GAGAGCAGCACGAAGGCACCTGG + Intronic
1160525274 18:79532164-79532186 GGGTGCTGCACGCAGGCACAGGG - Intergenic
1163284502 19:16338066-16338088 GTGAGGTCCAAGCTGGCACGGGG - Intergenic
1164540914 19:29120934-29120956 GAGAGCTGCAGGCAGACTCGGGG + Intergenic
1164600749 19:29561761-29561783 GGGAACTCCACCCAGGCACGTGG + Intronic
1167202159 19:48073435-48073457 GAGTCCTCCAGGCAGGCACTTGG + Intronic
1167696694 19:51019358-51019380 GAGCGCTCCACTCGGGCACAGGG - Intronic
925461486 2:4067198-4067220 GAGCGCTCCCAGCAGGCAGGTGG + Intergenic
926284153 2:11474209-11474231 GAGACCACCAGGCAGGCAAGCGG - Intergenic
927671665 2:25073698-25073720 GGGAGCTCCTTGCAGGCACCTGG - Intronic
927719030 2:25371554-25371576 GAGAGCACCATCCAGGCATGTGG - Intergenic
935589885 2:104836472-104836494 GAGAGCTCCACACAGGCCCCTGG - Intergenic
937877447 2:126836366-126836388 GAGAGCTGCGGGCAGGAACGCGG - Intergenic
938407638 2:131041272-131041294 GAGAGCTCCACGCAGGCGTTGGG - Exonic
942604419 2:177675447-177675469 GAGATCTCCAGACAGGCAAGTGG - Exonic
947765240 2:232633618-232633640 GCGCGCTCCTCGCAGGCTCGAGG - Exonic
1176250974 20:64119781-64119803 GAGTGCACCCCGAAGGCACGTGG + Intergenic
1176939929 21:14911808-14911830 TAGAGCACCAAGCAGGCACCTGG - Intergenic
1179916984 21:44484032-44484054 GAGAGCTTCACACACGCACATGG - Intergenic
1180913457 22:19469460-19469482 GAGAGCACTAAGCAGGCAGGAGG + Intronic
1182316798 22:29453056-29453078 GAGAGGTCCCCACAGGCAGGAGG + Intergenic
1182411878 22:30194028-30194050 GAGTGATCCAAGCAGGCAAGGGG - Intergenic
1183727535 22:39597875-39597897 GAGAGCTCCCCTCAGGCCCAGGG - Intronic
1184693548 22:46128072-46128094 GAGTGCTCCAGGCAGGCGGGTGG - Intergenic
949903473 3:8838928-8838950 GACAGCTCCAAGCAGGAAAGGGG - Intronic
950431347 3:12952872-12952894 GAGGGCTCCAAGAAGGCATGTGG + Intronic
950489384 3:13294405-13294427 GAGAGCTGCACACAGTCACAGGG + Intergenic
960784987 3:121362700-121362722 GAGAGCACCAAGCAGGCTCTTGG - Intronic
961497876 3:127307252-127307274 TAGAGTTCCACGCTGGCATGAGG + Intergenic
967119059 3:186366392-186366414 GAGGGCCCCACCCAGGCAAGGGG - Intergenic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
971480922 4:27114423-27114445 GAGAGCTGTACGCAGGCCCTGGG - Intergenic
975139203 4:70902691-70902713 GAGCGCTCCGCGCAGTCCCGGGG - Intronic
979184115 4:117766548-117766570 GAGAGCTCCACCCAGCAATGTGG - Intergenic
985647217 5:1090657-1090679 CAGAGCTCCAGGCAGAGACGCGG + Intronic
985963898 5:3324993-3325015 AAGAGCTCCAGGCAGGGACAGGG - Intergenic
986114497 5:4758695-4758717 GAGAGCTCCACCCAGCAACGTGG + Intergenic
995916529 5:117252783-117252805 GAGAGCTCCATGCAGCAATGTGG + Intergenic
997260078 5:132459232-132459254 CAGAGCTCCAGGCAGTCATGGGG + Intronic
999828802 5:155299524-155299546 GGGAGCTTCATGCAGACACGTGG - Intergenic
1002000169 5:176192813-176192835 CAGAGCTCCACGGAGGCCCAGGG + Intergenic
1002254145 5:177946081-177946103 CAGAGCTCCACGGAGGCCCAGGG - Intergenic
1003404421 6:5816748-5816770 AAGGGCGGCACGCAGGCACGTGG - Intergenic
1005529584 6:26689605-26689627 GAGACCTTCACTCAGGAACGGGG + Intergenic
1005541212 6:26812042-26812064 GAGACCTTCACTCAGGAACGGGG - Intergenic
1006977723 6:38119223-38119245 GAGAGATCCAAGCAGGCAGGAGG - Intronic
1007251947 6:40501711-40501733 GAGAGAGGCACGCTGGCACGTGG - Intronic
1008851181 6:56024066-56024088 GAGAGCTCCACTCAGCAATGTGG - Intergenic
1009012018 6:57854114-57854136 GAGACCTTCACTCAGGAACGGGG - Intergenic
1012745536 6:103082511-103082533 GAGAGCTCCACACAGCAACATGG - Intergenic
1014233963 6:118934944-118934966 GAGAGCTCCAGCCAGGCAGCGGG + Exonic
1018740555 6:166725519-166725541 GACAGCTCCAGGCAGTCAGGGGG + Intronic
1019509843 7:1412339-1412361 GCGAACACCACGCAGGCACTCGG + Intergenic
1019659652 7:2217020-2217042 GAGAGCTCCCCGAGGGCAGGTGG - Intronic
1020515011 7:9107038-9107060 GAGAGCACCAAGCAGGCTCTGGG + Intergenic
1020993167 7:15227988-15228010 GAGAGCTCCACCCAGCAACATGG - Intronic
1023143542 7:37126763-37126785 CATGGCTCCACGCAGGCACGTGG + Intronic
1023658860 7:42453193-42453215 GACAGCTCCACACAGGCAAATGG - Intergenic
1023976995 7:45037850-45037872 GAGAACTCCAGGAAGGCAGGTGG - Intronic
1024051483 7:45626555-45626577 GAGAGCTCCACGTGCCCACGAGG + Intronic
1034754340 7:153600892-153600914 GTGGGCTCCAGGCAGGCAGGTGG + Intergenic
1034850677 7:154490471-154490493 CAGAGCCCCAGGCAGCCACGGGG - Intronic
1035451389 7:158979354-158979376 AAGAGCTCCAGGGAGGCAGGAGG - Intergenic
1035861566 8:3034068-3034090 GAGAGCTCCACCCAGCAATGTGG - Intronic
1041991912 8:64002913-64002935 GAGAGCTCCACCCAGCAATGTGG - Intergenic
1043126591 8:76404115-76404137 GAGAACTCCACGCCGGAATGGGG - Intergenic
1043526266 8:81099726-81099748 GAGAACTGCACACAGGCACAAGG + Intronic
1043609186 8:82041338-82041360 GGGAGCTGCAAGCATGCACGAGG - Intergenic
1043637710 8:82407265-82407287 GAGAGCTCCACCCAGCAATGTGG + Intergenic
1044164081 8:88958999-88959021 GAGAGCTCTAGGCATGCATGAGG + Intergenic
1044193057 8:89342494-89342516 GAGAGCTCCAAGAAGGCTCTTGG - Intergenic
1047088358 8:121544891-121544913 GAGAGTTCCACCCAGTAACGTGG - Intergenic
1048073136 8:131041490-131041512 CAGAGCTCCAGGGTGGCACGCGG - Exonic
1049814507 8:144591873-144591895 CAGCACTCCCCGCAGGCACGAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062333905 9:136056597-136056619 GAGAGTTCCACCCAGGAAAGGGG + Intronic
1062513856 9:136922479-136922501 GGGAGCTGCACTCAGGCAAGAGG + Intronic
1188068873 X:25695211-25695233 CAGAGCACCAAGCAGGCACTTGG - Intergenic
1193147487 X:78092570-78092592 TAGAGCACCAAGCAGGCACTTGG - Intronic
1193683722 X:84552658-84552680 TAGAGCACCAAGCAGGCACTTGG - Intergenic
1194835099 X:98672317-98672339 TAGAGCACCAAGCAGGCACTTGG - Intergenic
1195027800 X:100895558-100895580 GAGAGCTCCAAGGAGACACAGGG + Intergenic
1197249294 X:124198217-124198239 GAGGCCTCCCCCCAGGCACGTGG - Intronic