ID: 1102911365

View in Genome Browser
Species Human (GRCh38)
Location 12:116716874-116716896
Sequence GGGTTTCTATTGATAGAACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 2, 2: 3, 3: 6, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102911365 Original CRISPR GGGTTTCTATTGATAGAACA GGG Exonic
901281909 1:8044079-8044101 GGGTTTCTATGGATATCACCAGG + Intergenic
911853632 1:102851009-102851031 TGATTTCTATTGATAACACAGGG - Intergenic
916153382 1:161819141-161819163 TAGTTACTATTGATAGAAAATGG + Intronic
920407964 1:205733424-205733446 GTGTTTCTAGTGATAGAGTAAGG - Intronic
923436809 1:233975235-233975257 GGGTTTCTGTGGATAAAATAAGG + Intronic
1065477991 10:26161715-26161737 TGGATTTTATTGATAGAACCAGG + Intronic
1067150620 10:43729642-43729664 GGGTTTCTATTGACAGAACCAGG - Intergenic
1068228563 10:54138800-54138822 GAGTTTCTATTGCTATATCATGG + Intronic
1072300621 10:94058070-94058092 GGGTTTCTATTGTAAAAAGATGG - Intronic
1072350975 10:94556619-94556641 GGCTATCTGTGGATAGAACATGG - Intronic
1075229564 10:120663642-120663664 TGATTTCTTTTGATAGAAAATGG - Intergenic
1078471762 11:11593252-11593274 GGGTTTGTTATGATAGAACAGGG - Intronic
1079323689 11:19473590-19473612 GGGTTCTGATTGACAGAACATGG - Intronic
1079606794 11:22379630-22379652 GGGGATCTAATGAAAGAACATGG + Intergenic
1079723774 11:23852739-23852761 AGGTTTCTAATGGTAAAACAGGG + Intergenic
1081332009 11:41813961-41813983 GGGTACCTAATGTTAGAACAAGG - Intergenic
1081597621 11:44469965-44469987 GGATTTCTATAGACAGAAGAGGG - Intergenic
1081749820 11:45501948-45501970 GGGTTCCTGTTTATAAAACAAGG - Intergenic
1083383496 11:62288701-62288723 GGGTCTTTATTTACAGAACAAGG - Intergenic
1084738941 11:71125746-71125768 GGTCTTCTATTGAAAGAAGATGG + Intronic
1087050073 11:93878003-93878025 GGGATTTTATTTATATAACAAGG - Intergenic
1088425843 11:109701353-109701375 GGGTTTTTATTTATTGAATAAGG - Intergenic
1088475035 11:110227250-110227272 AAGTTTCTTTTGATAAAACATGG - Intronic
1091169933 11:133511019-133511041 GGAGTTCTATTGGTGGAACAGGG - Intronic
1091693754 12:2614214-2614236 GGTTTTCTATTGTGAGAAGATGG + Intronic
1092966085 12:13644422-13644444 GTTTTTCCATTGATAGAGCATGG + Intronic
1095240745 12:39856197-39856219 GGGTTGCTATTGATAAGAGAAGG - Intronic
1099681096 12:85828910-85828932 GAGATTCTATTGATAAACCATGG - Intronic
1102911365 12:116716874-116716896 GGGTTTCTATTGATAGAACAGGG + Exonic
1104756379 12:131272178-131272200 GGGTATTTATTGAATGAACATGG + Intergenic
1104776950 12:131395236-131395258 GGGTATTTATTGAATGAACATGG - Intergenic
1105750147 13:23415742-23415764 GGGTTTCCATTTATAGTAGATGG - Intronic
1106116132 13:26819415-26819437 GGTTTTCTTTTGATTGAACAAGG - Intergenic
1106763082 13:32886864-32886886 GGGTGTTTGTTGATAAAACAAGG + Intergenic
1108025279 13:46171009-46171031 GGCTTTCTATAGAGAGAGCATGG - Intronic
1108527572 13:51299157-51299179 GGGTTACTATGCACAGAACATGG + Intergenic
1111425604 13:88077021-88077043 AGGATTCTATTGTTAGGACAAGG - Intergenic
1113555591 13:111231579-111231601 GGGTTTCTGTTGCCAGAAGATGG + Intronic
1113668346 13:112156691-112156713 GGGTTACTATTAATATTACAGGG + Intergenic
1114713441 14:24801631-24801653 GGGCTTTTGTTGATGGAACAAGG + Intergenic
1120159363 14:81129346-81129368 GTGTTTATAATGACAGAACATGG - Intronic
1120275160 14:82363942-82363964 GGGTTTATTTTGAAATAACATGG + Intergenic
1120618914 14:86738913-86738935 GAGCTTCTATTGATATAACTAGG - Intergenic
1125477511 15:40057240-40057262 AGGTTTCTATTGATAGTACTGGG + Intergenic
1128386206 15:67150388-67150410 AGATTTGTTTTGATAGAACAAGG + Intronic
1129142081 15:73608632-73608654 GGGCTTCTTTCCATAGAACAAGG + Intronic
1131876151 15:96808233-96808255 GGGTTTCTATTCAGGAAACATGG + Intergenic
1134786703 16:16951309-16951331 GGGTTTCTATTGACAGAACAGGG + Intergenic
1135794160 16:25425452-25425474 GGGTCTCTATGGAAAGAAGATGG + Intergenic
1143249886 17:5515294-5515316 GGGTCTCTGTGGATAGGACAAGG + Intronic
1146006473 17:29163695-29163717 GGTTTTCTCTTTATAGCACAGGG - Intronic
1146801495 17:35827395-35827417 GGGTTTATATTAAAAGAAGAAGG + Intronic
1149224614 17:54454669-54454691 GGGTACCTTTGGATAGAACATGG + Intergenic
1150169585 17:62979224-62979246 GGGTTTCTCATGATATAAAAGGG - Intergenic
1153493546 18:5674208-5674230 TGGGTTCTGTTGATGGAACAAGG + Intergenic
1155900870 18:31388600-31388622 GGATTACTTTTGATAAAACATGG + Intronic
1156941676 18:42775050-42775072 CAGTTTATATTGATATAACAGGG + Intronic
1157368003 18:47084315-47084337 TGGTTACTATGGAAAGAACAAGG - Intronic
1157912536 18:51630813-51630835 GGGGTTTTATTTATATAACAAGG + Intergenic
1166420130 19:42630229-42630251 GGGTTCATAGGGATAGAACATGG + Intronic
926883707 2:17577613-17577635 GGGTAGCCATTGAAAGAACAGGG - Intronic
928365367 2:30696323-30696345 GGGCTTCTATGGAAAGAACGTGG + Intergenic
930680366 2:54251199-54251221 GTGTTTCTATTCTTAGAAAATGG + Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
935175876 2:100648333-100648355 GGGTTTTTATGGACAGAAGATGG - Intergenic
935713900 2:105922915-105922937 GGGTTTTTATTAATAGAATGTGG - Intergenic
936591111 2:113805666-113805688 GGGCTTCTGTTGAAAGAATAAGG + Intergenic
936682727 2:114793070-114793092 GGGCTTCTACTGATAAAACTGGG - Intronic
939359831 2:141156307-141156329 GGGAATGTATTGACAGAACAGGG - Intronic
939490727 2:142873418-142873440 GGGTTTCTTTCTATAGTACAAGG - Intergenic
941043904 2:160651477-160651499 GCTTTGCTATTGATAGAACCCGG + Intergenic
941479520 2:165988823-165988845 GGGTTTCTTTTCATAGCTCAAGG + Intergenic
946951317 2:224878377-224878399 GGGATTATATTGATAGCAAATGG + Intronic
1169673114 20:8126283-8126305 GTGTTTATTTTTATAGAACAGGG + Intergenic
1173115295 20:40236074-40236096 GGGTATCCATTGATATAAGAAGG + Intergenic
1175742848 20:61432731-61432753 GTTTTCCTATAGATAGAACATGG - Intronic
1177508729 21:22053782-22053804 GGGCTTCTATTGAGAGAGCTGGG + Intergenic
1177594324 21:23216023-23216045 GGGTTTTTATAGACAGAACCAGG + Intergenic
1182077659 22:27505889-27505911 GGGCTTCAATTGAGAGAAGAGGG + Intergenic
949462427 3:4307320-4307342 GGGTTCCTATCCATAGGACAAGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
955190307 3:56755561-56755583 GGGATTCTATTTATAGAAGGAGG - Intronic
955544614 3:60014552-60014574 TGGTTTCTCTAGGTAGAACATGG + Intronic
957410251 3:79830797-79830819 GGGTTTCTATGGATACAGGATGG + Intergenic
957651878 3:83017951-83017973 GGTTTTCTACAGAGAGAACAAGG - Intergenic
958222241 3:90705279-90705301 GGGTTTCTTCTGATAAAACGTGG - Intergenic
959280500 3:104332160-104332182 GACTTTCTATTGATAGAATCAGG - Intergenic
960180299 3:114567905-114567927 GGGGTTCCATTGATAGCACTTGG + Intronic
963257488 3:143160362-143160384 GGGTTTCTCTTCATAGAACCTGG + Intergenic
964050930 3:152392755-152392777 GTGTTTGTATTGCCAGAACATGG - Intronic
965862757 3:173166998-173167020 CATTTTCTATTGAGAGAACAAGG - Intergenic
966438089 3:179911325-179911347 GGGTTTCTGTTGATAGAACATGG + Intronic
966865553 3:184257367-184257389 GGGTTTGGATTGAGAGAAAACGG + Intronic
970114924 4:12684250-12684272 GGGTCACTATTGAAAGAAAAGGG - Intergenic
970718250 4:18954072-18954094 GAGTTTTGATTGATAGAACGAGG + Intergenic
971931371 4:33088179-33088201 GGGTTTCTATTTATAGCAAATGG + Intergenic
973011207 4:45076437-45076459 AGGTTTCTAGTGAGTGAACATGG - Intergenic
973185298 4:47320333-47320355 GGGTTTATATTGGTAGCTCAAGG + Intronic
974706633 4:65526179-65526201 GGGTCACTATTGATACTACATGG + Intronic
979509754 4:121538901-121538923 GGGTTTCTGTTGGAAAAACAGGG - Intergenic
982117260 4:152107951-152107973 TGGTTTCTTTTTAGAGAACAAGG + Intergenic
984697731 4:182796169-182796191 GGGGTTTTATTAATAGAAAATGG + Intronic
987460271 5:18200115-18200137 GGGGTTTTATTTATATAACAAGG + Intergenic
987526580 5:19058135-19058157 TGTTTTCTCTTGATGGAACAAGG - Intergenic
988641101 5:33041505-33041527 GGGTTTCTATTGATAGAAATTGG - Intergenic
989494146 5:42091528-42091550 AGTTTTCTATTTATAGAATAAGG + Intergenic
994209573 5:97073088-97073110 GGGTTTATATTGGTACAAGATGG - Intergenic
995385307 5:111582001-111582023 AGGGTTCTACTGATAGCACAGGG - Intergenic
996552291 5:124743738-124743760 GGTTTTCTATTAAAAGCACACGG + Intronic
1007974090 6:46082769-46082791 GGGTTTTTAGTAATGGAACAGGG - Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1018357492 6:163033899-163033921 GGGTCCCTAGGGATAGAACATGG - Intronic
1018975226 6:168559708-168559730 GGGTTGCTGTTGATAGAACAAGG - Intronic
1027146524 7:75699422-75699444 GGTTTTCAGTGGATAGAACAAGG + Intronic
1027236381 7:76300610-76300632 GTGTTTCTAAAGATAGAAGATGG + Intergenic
1033517768 7:142126772-142126794 GGGTTTCTTTGGAAAGATCAAGG - Intronic
1034073284 7:148208348-148208370 GGGTTTCCCATGAAAGAACAAGG + Intronic
1034124416 7:148658092-148658114 AGGTTTCTGTTGTTAGAAAAAGG + Intergenic
1040938460 8:52806870-52806892 GGGTTTCTATTGATGTTAAAGGG + Intergenic
1042464131 8:69107588-69107610 GGGTTTCTGTTCATAGGGCATGG - Intergenic
1043795235 8:84528953-84528975 TGGTTGCTGTTGATAGAATAAGG + Intronic
1044114383 8:88316477-88316499 GTTGTTCTATTGATAGAGCAGGG - Intronic
1046534836 8:115496003-115496025 GGGGTTCTAGTGGTAGAACGAGG - Intronic
1049456074 8:142689999-142690021 GGGGTTTTATTTACAGAACAAGG - Intergenic
1050586149 9:7113555-7113577 TGCTTTCTGTTGATAGAGCAAGG + Intergenic
1051188918 9:14490226-14490248 GTGTTTTGATTGATAGAGCAAGG + Intergenic
1051544128 9:18254916-18254938 GGGTTTCTATTGCTAAGACAAGG - Intergenic
1052301090 9:26953517-26953539 GAGTGTCTATTGAAAGAAGATGG - Intronic
1056113143 9:83415885-83415907 TGTTTTCTATTGATTGGACATGG + Intronic
1056855834 9:90128825-90128847 GGGTTGCTTTTTATAGCACACGG - Intergenic
1058429074 9:104902024-104902046 AGGTCTCTAGTGAGAGAACAGGG - Intronic
1061653282 9:132068315-132068337 GGCTTTCTAGTAATAGTACACGG - Intronic
1186620113 X:11231515-11231537 GGGTTTCTCCTGATAGCAGAGGG + Intronic
1186794693 X:13033574-13033596 GGGTTTCTTTTGATACCAGAGGG - Intergenic
1192716342 X:73646735-73646757 GGTTTTCTATTTATAGGATAAGG + Intronic
1195724750 X:107902955-107902977 GGGTTTCACTTGACAGAACTCGG + Intronic
1195851543 X:109287668-109287690 TGGTTGCTATGGATAGAATAGGG + Intergenic
1196684494 X:118498688-118498710 GTGTATCTCTTGTTAGAACATGG + Intronic
1197048019 X:122023700-122023722 GCTTTTCTTTTGATGGAACATGG + Intergenic
1197277044 X:124491691-124491713 TTATTTCCATTGATAGAACAAGG - Intronic
1198552830 X:137762626-137762648 GGATTTCTATAGGTAGAAAAGGG - Intergenic
1199200447 X:145081453-145081475 TGTTTTATATTTATAGAACATGG - Intergenic
1199451003 X:147979039-147979061 GGGTTTCTAATGGTATAACGTGG + Intergenic