ID: 1102911763

View in Genome Browser
Species Human (GRCh38)
Location 12:116720494-116720516
Sequence CATGGTCATCCCTGGTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102911763_1102911768 10 Left 1102911763 12:116720494-116720516 CCTCCCTACCAGGGATGACCATG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1102911768 12:116720527-116720549 GAAAGTACACAGACAGAAGCTGG 0: 1
1: 0
2: 5
3: 23
4: 382
1102911763_1102911770 18 Left 1102911763 12:116720494-116720516 CCTCCCTACCAGGGATGACCATG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1102911770 12:116720535-116720557 ACAGACAGAAGCTGGAGTCTGGG 0: 1
1: 0
2: 1
3: 44
4: 350
1102911763_1102911771 19 Left 1102911763 12:116720494-116720516 CCTCCCTACCAGGGATGACCATG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1102911771 12:116720536-116720558 CAGACAGAAGCTGGAGTCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 369
1102911763_1102911769 17 Left 1102911763 12:116720494-116720516 CCTCCCTACCAGGGATGACCATG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1102911769 12:116720534-116720556 CACAGACAGAAGCTGGAGTCTGG 0: 1
1: 0
2: 2
3: 31
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102911763 Original CRISPR CATGGTCATCCCTGGTAGGG AGG (reversed) Intronic
902248799 1:15139945-15139967 CTTTGTCACCCCTGGTAGGCAGG - Intergenic
904365396 1:30007868-30007890 GATGCCCATCCCAGGTAGGGTGG - Intergenic
904970520 1:34416046-34416068 AATGGTCATCCATCCTAGGGAGG + Intergenic
905031188 1:34885531-34885553 CAAGACCATCCCTGGCAGGGAGG - Exonic
909526335 1:76626820-76626842 CATGGTAATCACTGTTATGGAGG - Intronic
910761747 1:90739705-90739727 CATGGACATCTCTGACAGGGTGG - Intergenic
911161327 1:94685467-94685489 CATGGCGATCCCTGGTTGGCTGG + Intergenic
912100215 1:106194325-106194347 CATAGGCATCCCTGAAAGGGAGG + Intergenic
912639258 1:111329463-111329485 CATTGGCATCCCTGAAAGGGAGG - Intergenic
915556913 1:156665798-156665820 CTTGGTAATCCACGGTAGGGAGG - Intergenic
920032996 1:203048533-203048555 GGTGGTCCTCCCTGGGAGGGCGG + Intronic
921236410 1:213136346-213136368 TTTGGTCATCCCTGGGAAGGTGG + Intronic
922255472 1:223889662-223889684 CTTGGTCACCCCTGGCAAGGTGG + Intergenic
923484123 1:234412883-234412905 CATGACCATCCCTGCTGGGGTGG - Intronic
923735061 1:236598793-236598815 CATGGTGATCCAGGGTAGGGGGG - Intronic
924267922 1:242301517-242301539 CATTGTCCTTCCTGGTAGAGAGG - Intronic
1063500952 10:6553845-6553867 CAAGGTTATCCCTGGGAGGCAGG + Intronic
1066745386 10:38601709-38601731 GTTGGTCCTCCCTGGTAGGCGGG - Intergenic
1067918043 10:50421812-50421834 CATGCTCATCCCTGGTGGAGAGG + Intronic
1076125099 10:127967807-127967829 AATGGTTACCCCTGGAAGGGAGG - Intronic
1076163080 10:128261006-128261028 CATGATCCTCCCTTGCAGGGAGG - Intergenic
1077742550 11:4862858-4862880 CATTGTCATTTCTGGGAGGGAGG - Intronic
1077799028 11:5520123-5520145 CATTGTCAACCTTGCTAGGGAGG - Intronic
1083017878 11:59475109-59475131 AATGTTCATCCATGGTAGGTGGG - Intergenic
1083462781 11:62825604-62825626 GATGGCCATCTCTGGTAGGAAGG + Intronic
1083615201 11:64022715-64022737 CACTGTCCTCCGTGGTAGGGCGG + Intronic
1084968358 11:72756102-72756124 CAGGGGCATTCCTGGGAGGGAGG - Intronic
1089462069 11:118659361-118659383 CCTGGTCATCAGAGGTAGGGAGG - Exonic
1089650805 11:119911521-119911543 CATGGTCATTCCCTTTAGGGAGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1094292873 12:28871950-28871972 AATTGCCATCCCTGGTAGAGAGG - Intergenic
1094852165 12:34387125-34387147 CATGGGCATGCGTGGTTGGGGGG + Intergenic
1094853220 12:34391645-34391667 CATGGGCATGCATGGTGGGGAGG - Intergenic
1096810773 12:54168368-54168390 CATTGGCATCCCTGGAAGCGTGG + Intronic
1099227686 12:79989455-79989477 CATGGTCATCCATGGCTTGGTGG + Intergenic
1101421612 12:104555680-104555702 CATGGCCATGCCTGGGAGGCTGG + Intronic
1101803404 12:108042403-108042425 CCAGGGCATCCCTGGTGGGGCGG + Intergenic
1102911763 12:116720494-116720516 CATGGTCATCCCTGGTAGGGAGG - Intronic
1104831039 12:131751600-131751622 CAACGTCATCCCTGGAAGGGGGG - Intronic
1105002703 12:132701661-132701683 CATAGGCATCCCTGGCATGGGGG - Intronic
1109317225 13:60764576-60764598 CACTGTCATCCCTGAAAGGGAGG - Intergenic
1113469084 13:110531690-110531712 CATGGGCAGCCCTGGGACGGTGG - Intronic
1114163601 14:20196145-20196167 CCTCGTCCTCCCTGGTAGAGAGG + Intergenic
1116432884 14:44866864-44866886 CATGGGCCTCCCTGGTACTGGGG + Intergenic
1117947394 14:61042967-61042989 CATGGTCACCTGTGGTAGGGAGG - Intronic
1122071989 14:99210897-99210919 CATTGTCATCGTTGGTAGAGGGG - Intronic
1122071995 14:99210946-99210968 CATTGTCATCGTTGGTAGAGGGG - Intronic
1124654890 15:31499920-31499942 CATGGGCATCCTTTGAAGGGAGG + Intronic
1132565954 16:623073-623095 CATGGCCATCCCAGGAAGTGGGG + Intronic
1133910434 16:10061035-10061057 GTTGGTCATCTCTGATAGGGAGG - Intronic
1136737687 16:32477940-32477962 GTTGGTCCTCCCTGGTAGGCGGG + Intergenic
1136746703 16:32597316-32597338 CATGGTCTACCCTGGGAAGGTGG + Intergenic
1140959905 16:79901778-79901800 CATGCCCATCAGTGGTAGGGTGG - Intergenic
1141390853 16:83662096-83662118 CATTGGCATCCCAGGTAGTGTGG - Intronic
1141467326 16:84214942-84214964 CATGGCCACCCCTGGCAGTGTGG + Intergenic
1203015384 16_KI270728v1_random:351637-351659 GTTGGTCCTCCCTGGTAGGCGGG - Intergenic
1203033719 16_KI270728v1_random:624795-624817 GTTGGTCCTCCCTGGTAGGCGGG - Intergenic
1203048832 16_KI270728v1_random:856520-856542 CATGGTCTACCCTGGGAAGGTGG + Intergenic
1143729349 17:8872071-8872093 CATGGTTATCACTGGGTGGGAGG - Intergenic
1145993555 17:29093177-29093199 CATCGTCATCCCTTGTGGGATGG - Intronic
1147560692 17:41507203-41507225 CATTGTCAGCCCTGGAATGGAGG - Intergenic
1148467989 17:47876361-47876383 AATGGTCATCCATGGTAATGCGG - Intergenic
1148669823 17:49402287-49402309 CTTTGCCATCCCTGGCAGGGAGG + Intronic
1150289000 17:63971153-63971175 CACGGTCATCCCAGGTACTGGGG - Exonic
1152728390 17:81958718-81958740 GATGGTCCTTCCTGGTGGGGAGG - Intronic
1154008988 18:10559612-10559634 CAAGGTCCACCCTGGGAGGGTGG + Intergenic
1162478290 19:10913912-10913934 CGTGGTCATCCCGGGCAAGGTGG + Exonic
1162529217 19:11226119-11226141 GATGGTCACCCCTGTTAGGTGGG + Intronic
1165912870 19:39239964-39239986 CATGGTCATCCCTAGCATGCAGG - Intergenic
1167040110 19:47019080-47019102 CAGGGTCCTCCCTGGCATGGGGG - Intergenic
1167746167 19:51353080-51353102 CTTGCTCATCCCTGCTCGGGAGG - Intronic
1168696682 19:58407893-58407915 CATGGTGATCTCAGGTATGGGGG - Intronic
928200228 2:29243195-29243217 CAAGGTCCTCCCTGGGAGGGAGG - Intronic
929347149 2:40898218-40898240 CAGGGGCATTCCTGGTGGGGTGG + Intergenic
931775621 2:65538052-65538074 CACTGTCAGCCCGGGTAGGGGGG - Intergenic
934188811 2:89767053-89767075 GTTGGTCCTCCCTGGTAGGCGGG + Intergenic
934307785 2:91840900-91840922 GTTGGTCCTCCCTGGTAGGCAGG - Intergenic
936118597 2:109722359-109722381 CATGCTCATAGCTGGAAGGGAGG + Intergenic
937973969 2:127569958-127569980 CATGGTCCTACCTGGCAGGAAGG - Intronic
938213756 2:129490797-129490819 CATGGTCCTCCCTTGTAGCATGG - Intergenic
939582007 2:143961676-143961698 CATGGTCTTCCCTGGTAGGATGG + Intronic
941617846 2:167741616-167741638 CATGGTCCACCCTGGCAGGGAGG - Intergenic
942807012 2:179942779-179942801 CATTGTCATCCCCGTTAGGTTGG - Intergenic
943425342 2:187724855-187724877 CATTGACATCCCTGAAAGGGAGG - Intergenic
943662355 2:190572509-190572531 GCTGGGCATCCCTGGTAGGTAGG + Intergenic
947863494 2:233379553-233379575 GATGCTCATCACTGGTGGGGTGG + Intronic
947950162 2:234139878-234139900 CATTGTTATCCCGGGTAGAGTGG - Intergenic
948529252 2:238593526-238593548 CGTGGTCTTCCCTGTTAGTGGGG + Intergenic
948798343 2:240418550-240418572 CATGGCCAGCCCTGGAAGGAAGG + Intergenic
1168841790 20:914450-914472 CATGGTTAGCCCTGGGAGGAGGG + Intronic
1173264107 20:41462060-41462082 CATGATCATCCCTAGTAGCAGGG - Intronic
1173264487 20:41466840-41466862 CCTGGCCATCCCTGGGAGGCTGG - Intronic
1173424628 20:42932104-42932126 CATAGTCACCCCTGGTCGTGTGG - Intronic
1176285799 21:5018886-5018908 CATGGGCATCCTTTGGAGGGTGG - Intergenic
1177085053 21:16693495-16693517 CATGATGATTCCTAGTAGGGAGG + Intergenic
1178513993 21:33230509-33230531 CCTGGGCATCCTTGGTGGGGTGG - Intronic
1179871382 21:44244589-44244611 CATGGGCATCCTTTGGAGGGTGG + Intergenic
1179913259 21:44461142-44461164 CAGGACCATCCCTGGTGGGGTGG + Exonic
1180130903 21:45826565-45826587 CTTTGTCATGCCTGGTGGGGAGG - Intronic
1180534866 22:16387982-16388004 GTTGGTCCTCCCTGGTAGGCGGG - Intergenic
1184559622 22:45254590-45254612 CACTTTCATCTCTGGTAGGGAGG - Intergenic
1184836151 22:47022315-47022337 CCGGGCCATCCCTGGGAGGGAGG + Intronic
1185399956 22:50610572-50610594 CATGGCCATGCCTGGGTGGGGGG + Intronic
949179570 3:1112407-1112429 CATGGGCTTCCCTGGTTTGGGGG - Intronic
953547645 3:43875401-43875423 AAGTGCCATCCCTGGTAGGGTGG - Intergenic
953786821 3:45917293-45917315 CCTGGTCATCCCTGGAGTGGGGG + Intergenic
954461258 3:50628254-50628276 CCTGGCCACCCCTGCTAGGGAGG + Intronic
954486587 3:50858768-50858790 CATTGGCATCCCTGAAAGGGAGG - Intronic
956362061 3:68459122-68459144 CAGGGTGCTCCCTGGGAGGGGGG + Intronic
957593012 3:82225098-82225120 AATGATCATCCGGGGTAGGGTGG + Intergenic
960857369 3:122116861-122116883 CATGGTTATCCATGGGATGGGGG + Intronic
961513527 3:127419181-127419203 CATGGTCCTCCGTGGCAGGGAGG + Intergenic
961721630 3:128900731-128900753 CATGGTCATACCTAGCAGGCAGG + Intronic
965113132 3:164452066-164452088 TATGCTCATCACTGGTGGGGTGG + Intergenic
967426821 3:189337176-189337198 CATCTTCATCCCAGTTAGGGTGG - Intergenic
969566021 4:7978699-7978721 AATGGTTATCACTGGTGGGGTGG - Intronic
971894465 4:32574026-32574048 TCTTGTCATTCCTGGTAGGGTGG - Intergenic
976709182 4:88050915-88050937 TATGGTCATCTCAGGAAGGGAGG + Intronic
980005343 4:127535886-127535908 CTTTGTCATTCCTGGTAGAGAGG + Intergenic
981183558 4:141774453-141774475 CTGAGTCATCCCTGGGAGGGGGG - Intergenic
983431523 4:167657145-167657167 CATTGGCATCCCTGAAAGGGAGG + Intergenic
983781215 4:171673030-171673052 CATGGTCATTCTTTGTAAGGAGG - Intergenic
986473409 5:8097956-8097978 CAATGTCAGCCATGGTAGGGTGG + Intergenic
991157967 5:63460497-63460519 CATTGGCATCCCTGAAAGGGAGG + Intergenic
993715948 5:91276046-91276068 CATGGTCACCCCTGGAAGCTAGG + Intergenic
998539652 5:142968532-142968554 TGTGGTCATCCCTAGAAGGGAGG - Intronic
1002453830 5:179334254-179334276 CATGGGAAGCCCTCGTAGGGAGG - Intronic
1002549866 5:179979682-179979704 CAGGGTCATCCCTGGTGGCTTGG - Intronic
1003180208 6:3784563-3784585 CATGGGCAGCCCAGGTAGGTAGG + Intergenic
1003540960 6:7017667-7017689 CATGGTCAGCCCAGGGAGTGGGG + Intergenic
1004968295 6:20879324-20879346 CTTGGTCTTCCCTGGTCAGGAGG + Intronic
1015005819 6:128280279-128280301 CATACTCATCCCTGGGAGGCTGG + Intronic
1017647322 6:156551288-156551310 CATAGACATCTCTGGTGGGGTGG - Intergenic
1018072515 6:160177718-160177740 CATGGTCAGGCCTGGTGTGGTGG - Intronic
1018704020 6:166450178-166450200 CATGGTGATCCCTGTTGTGGTGG - Intronic
1019067054 6:169311095-169311117 CATGGTCCTCCATGGGATGGGGG + Intergenic
1019429062 7:990426-990448 CATGGTCAGCGCTGGGACGGGGG - Intergenic
1021531141 7:21646726-21646748 CAGGGTCTTTCCTGGTAGCGGGG + Intronic
1024097263 7:45992360-45992382 CATGGCCATCCTTTGCAGGGTGG - Intergenic
1031288137 7:119898837-119898859 CATTGGCATCCCTGAAAGGGAGG + Intergenic
1032144740 7:129368780-129368802 CCTGGTCATCTCTGGTGGGCAGG + Intronic
1037714876 8:21388761-21388783 TATGGTGATACCTGGTGGGGTGG - Intergenic
1042584623 8:70321989-70322011 CATGGTAATCCCAGGTACGTGGG + Intronic
1043034587 8:75179569-75179591 CTTGGTCAGCCCTGGTGGTGTGG - Intergenic
1044126064 8:88458888-88458910 CATTGGTATCCCTGGAAGGGAGG + Intergenic
1052796099 9:32924886-32924908 CAAGGCCATACCTGGTGGGGAGG + Intergenic
1056535906 9:87527445-87527467 CATGGTCATCCGTGTAAGGCCGG - Intronic
1059324265 9:113494299-113494321 AATGGTCATATCTGGTAGGTGGG - Intronic
1059483987 9:114612833-114612855 GATGGTGATCCCTAGCAGGGAGG + Intronic
1061446255 9:130640006-130640028 CATGGTCATCACTGTAAGGGCGG + Intergenic
1188843013 X:35038757-35038779 CATTGGCATCCCTGAAAGGGAGG + Intergenic
1189059259 X:37735540-37735562 CATTCTCCTCCCTGCTAGGGTGG - Intronic
1190384334 X:49869958-49869980 TATGGTCATGACTGGTTGGGGGG + Intergenic
1194212984 X:91091682-91091704 CATTGGCATCCCTGAAAGGGAGG - Intergenic
1194462715 X:94192433-94192455 CTTTGTCATTCCTGGTAGAGAGG - Intergenic
1196467674 X:115990010-115990032 CATGGTATTAGCTGGTAGGGAGG + Intergenic
1199249169 X:145639426-145639448 CATTGGCATCCCTGAAAGGGAGG + Intergenic
1201609170 Y:15821917-15821939 CATGCTCATCAGTGATAGGGTGG + Intergenic