ID: 1102913764

View in Genome Browser
Species Human (GRCh38)
Location 12:116737910-116737932
Sequence GACGTGGGGCGCGGCGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 390}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102913744_1102913764 28 Complete closest: 28
total_pairs: 3
max_distance: 1000
Left 1102913744 12:116737859-116737881 CCGCAGAAGCCGGCGCCACACCA 0: 2
1: 0
2: 0
3: 10
4: 113
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913746_1102913764 19 Complete closest: 19
total_pairs: 3
max_distance: 1000
Left 1102913746 12:116737868-116737890 CCGGCGCCACACCATGGCCGCCA 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913752_1102913764 -1 Complete closest: 164
total_pairs: 2
max_distance: 1000
Left 1102913752 12:116737888-116737910 CCAGGTTCACCATCCCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913751_1102913764 2 Complete closest: 164
total_pairs: 2
max_distance: 1000
Left 1102913751 12:116737885-116737907 CCGCCAGGTTCACCATCCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913749_1102913764 8 Complete closest: 8
total_pairs: 3
max_distance: 1000
Left 1102913749 12:116737879-116737901 CCATGGCCGCCAGGTTCACCATC 0: 1
1: 0
2: 2
3: 12
4: 151
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913748_1102913764 13 Complete closest: 13
total_pairs: 3
max_distance: 1000
Left 1102913748 12:116737874-116737896 CCACACCATGGCCGCCAGGTTCA 0: 1
1: 0
2: 1
3: 18
4: 147
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390
1102913757_1102913764 -10 Complete closest: -10
total_pairs: 4
max_distance: 1000
Left 1102913757 12:116737897-116737919 CCATCCCGGCGCGGACGTGGGGC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG 0: 1
1: 0
2: 7
3: 39
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102913764 Original CRISPR GACGTGGGGCGCGGCGGCCG GGG Exonic
900091900 1:924344-924366 GAGTTGGGTCGCGGGGGCCGGGG - Intergenic
900115937 1:1027954-1027976 GCTGTGGGCCGGGGCGGCCGTGG - Intronic
900237479 1:1599707-1599729 CACGCGGCGCGCGGCGGCCGGGG + Exonic
900284054 1:1890860-1890882 GACCTGCCGAGCGGCGGCCGAGG - Exonic
900671300 1:3856809-3856831 GGCGCGGGGCGCGGGCGCCGCGG - Intronic
900787100 1:4655817-4655839 GCCGCTGGGCGCGGCGGGCGCGG + Intronic
901086684 1:6615060-6615082 GTCGCGGGGGGCGGCTGCCGCGG + Intronic
902072304 1:13749936-13749958 GACGCGGGCCGCGTCGGTCGCGG + Intronic
902385588 1:16073678-16073700 ACCGCGGGGCGCGGCGGGCGGGG + Intergenic
902412096 1:16217642-16217664 GAGGAGGGGCGCGGCGGGAGGGG - Intergenic
902470372 1:16644652-16644674 GAACCGGGTCGCGGCGGCCGAGG - Intergenic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903199164 1:21719196-21719218 GACGGGGGGCGGGGGGGCAGAGG + Intronic
903777068 1:25800155-25800177 GGCCGGGGGCGGGGCGGCCGGGG - Exonic
903907410 1:26696505-26696527 GGCGGGGGGCGAGGCGGCGGCGG + Exonic
903950676 1:26994308-26994330 GGGGTCGGCCGCGGCGGCCGCGG - Exonic
905463073 1:38134004-38134026 GAGGAGGGAGGCGGCGGCCGGGG + Intergenic
905580772 1:39081631-39081653 GAGCTGGGGCGCGGCCGCCGGGG - Intronic
906495780 1:46303047-46303069 GCCGGGGGGCGCGGGGGGCGAGG - Intronic
906640506 1:47438217-47438239 GACGTGGTGGGCGGCGGCAGCGG + Exonic
907357638 1:53889629-53889651 GAGCTGGGCCGCGGCGGCCCGGG + Intronic
910760425 1:90726876-90726898 GCCGTGGGGCAAGGAGGCCGCGG + Intergenic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
915214105 1:154328768-154328790 GGCATGGGGGGCGGCGGCGGCGG + Intronic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
917530293 1:175829159-175829181 GACATGGGGGGCGGCGGCTGGGG - Intergenic
920367729 1:205456925-205456947 GTCGGGGGGCGCGGAGGGCGGGG - Intergenic
920600796 1:207321868-207321890 GAGTAGGGGCCCGGCGGCCGGGG + Intronic
922766383 1:228158644-228158666 GACGCGGTGCGCGGCCGCCGCGG + Exonic
923506509 1:234609911-234609933 GGCGGGGGGCGGGGAGGCCGGGG + Intergenic
1062874218 10:931981-932003 GACGGCGGGCGGGGCGGGCGGGG - Intergenic
1065214955 10:23439764-23439786 GACGTGTAGTGCGGCGGCAGCGG - Exonic
1066429371 10:35336965-35336987 GACGCGGGGCGCGGGCGGCGGGG - Exonic
1067140043 10:43648918-43648940 GCCGTGGGTCTCGGCGGCCCCGG + Intergenic
1067369815 10:45672776-45672798 GGGGCGGGGCGCGGCGGCAGCGG - Intronic
1070914530 10:80144504-80144526 CAGGTGGGGCGGGGCGGGCGGGG - Intronic
1072700941 10:97640934-97640956 GGCCCGGGGCGCGGCGGCCCAGG + Exonic
1073059356 10:100724284-100724306 GAGGCCGGGCGCGGCGGCCGCGG - Intergenic
1074995550 10:118754632-118754654 GACGAGGGGGGCGGCGGAGGTGG + Exonic
1075048646 10:119165746-119165768 GACGTCGGGCGCGCGGGCCTGGG - Intergenic
1075801703 10:125158965-125158987 GCCCTGGGGCTCGGAGGCCGCGG - Intronic
1075999787 10:126905574-126905596 GGCGAGAGGCGCGGCGGCGGCGG - Intronic
1076554143 10:131311312-131311334 GAAGGGGTGCGCGGCGGCGGCGG + Exonic
1076685578 10:132197104-132197126 GCCGTGGGGCAGGGCTGCCGTGG + Intronic
1077090789 11:777379-777401 AAGGTGAGGCCCGGCGGCCGGGG - Exonic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1077335510 11:2002034-2002056 GACCTGGGGCCACGCGGCCGTGG + Intergenic
1077378442 11:2216346-2216368 GAGGTGGGGCGCGGCCCTCGGGG - Intergenic
1077386116 11:2270285-2270307 GACGGGGGGCGCAGGGGGCGCGG + Exonic
1077404695 11:2377769-2377791 GTCGGGGGGCGCGGTGGCCCCGG - Intronic
1077419937 11:2445301-2445323 AACTGGGGGCGCGGCGGGCGCGG - Exonic
1077524763 11:3057432-3057454 GGCGTGGGGCGCGACTTCCGGGG - Exonic
1077916052 11:6612109-6612131 GACCGGGGGCGCGGGGCCCGGGG + Exonic
1079459790 11:20669532-20669554 GGCTGGGGGCGGGGCGGCCGGGG + Intronic
1081805068 11:45885930-45885952 GGCGAGGCGCGCGGCGGCCGGGG - Intronic
1081807988 11:45900463-45900485 AACGTGGGGGGCGGCGCCCTGGG + Intronic
1083033492 11:59615499-59615521 GACGGTGGTCGCGGCGGCGGCGG - Exonic
1083303756 11:61752543-61752565 GGCGCTGGGCGCGGCGGGCGGGG + Intergenic
1083315925 11:61815154-61815176 GGCGTGTGGGGCGGGGGCCGGGG + Intronic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083940016 11:65890725-65890747 GACGTGGGGCTCCTGGGCCGCGG + Exonic
1083945034 11:65918979-65919001 GGGGTGGGGCGCGGTGGCGGTGG - Exonic
1084171268 11:67401962-67401984 GACGTGAGGCGCGGCGGCCCGGG + Intronic
1084263242 11:67991887-67991909 GGTGCGGGGCGAGGCGGCCGCGG - Intronic
1084372034 11:68751002-68751024 GACCAGGGGAGGGGCGGCCGGGG + Intronic
1084489574 11:69471138-69471160 GACGGGCGGCGAGGGGGCCGGGG - Intergenic
1084516967 11:69642601-69642623 GAAATGCGGCGCGGCGGCCTGGG + Intronic
1084787187 11:71449079-71449101 GACCTGGGGCGAGGCAGCCCTGG + Intronic
1084810159 11:71607240-71607262 GGTGCGGGGCGAGGCGGCCGCGG + Intergenic
1085284641 11:75351757-75351779 GACGCGGCGGGCGGCGGGCGGGG - Intergenic
1087076131 11:94128787-94128809 GACGCGGGGCGGGGTGGGCGCGG - Intergenic
1090359091 11:126160403-126160425 GGCGTGGGGCGCAGTGGGCGGGG - Intergenic
1202818494 11_KI270721v1_random:57216-57238 GACCTGGGGCCACGCGGCCGTGG + Intergenic
1092127589 12:6085718-6085740 GAGGGGGGGCGCGGGGGGCGGGG + Intronic
1092659475 12:10722956-10722978 GACGTGGGCGGCGGGCGCCGGGG + Exonic
1094041076 12:26122474-26122496 GAAGGGGGCCGCGGCGGCCGCGG + Exonic
1096260224 12:50085560-50085582 GAGGAGGGGCGCGCGGGCCGGGG + Intronic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1097057477 12:56258469-56258491 GGCGGAGGGCGCTGCGGCCGGGG - Intergenic
1098991161 12:77065809-77065831 GACGCGGGCCCCGGCGGCCGCGG + Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1101409851 12:104458514-104458536 GCCCTCGAGCGCGGCGGCCGGGG + Intronic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1102997453 12:117361216-117361238 AACCCGGAGCGCGGCGGCCGCGG - Intronic
1103348353 12:120265761-120265783 GGCGGGGCGCGCGGCGGGCGCGG - Exonic
1103363682 12:120368397-120368419 GCGGTGGGGGGCGGCGGCAGTGG - Intronic
1103649617 12:122422575-122422597 GAGGCGGGAGGCGGCGGCCGCGG - Intronic
1104697273 12:130872498-130872520 CACGTGGGGCGCTGGGGGCGCGG + Intronic
1104891900 12:132144218-132144240 GCCGGAGGGCGCGGAGGCCGGGG - Exonic
1104929364 12:132329751-132329773 GACGGGGGGCGGGGCGCGCGGGG + Intergenic
1105011800 12:132761495-132761517 GCAGTTGGGCGAGGCGGCCGGGG - Intronic
1105380677 13:19884436-19884458 GACGTGGCGGCGGGCGGCCGTGG + Intergenic
1108518187 13:51222279-51222301 GGCGAGGGGCGGGGCGGGCGCGG + Intergenic
1110572977 13:77026710-77026732 GGGGGGGGGCGCGGGGGCCGGGG - Intronic
1110873366 13:80479251-80479273 GAGGTGGGGCCCGGCAGCCAGGG + Intergenic
1112170478 13:96967551-96967573 GGGGTGGGGCGTGGCGGCGGGGG - Intergenic
1113120043 13:106916439-106916461 GGGGTGGGGCGGGGGGGCCGGGG - Intergenic
1113378663 13:109784919-109784941 GGCGGCGGGAGCGGCGGCCGCGG - Exonic
1113813086 13:113154043-113154065 GAGGCGGGGCGCGGGGGGCGGGG + Intergenic
1113935983 13:113995769-113995791 GACGGGGGGCCCGGCTGACGGGG + Intronic
1113936004 13:113995816-113995838 GACGGGGGGCCCGGCTGACGGGG + Intronic
1113936012 13:113995832-113995854 GACGGGGGGCCCGGCTGACGGGG + Intronic
1114558510 14:23576020-23576042 GGCGGGCGGCGCTGCGGCCGGGG + Exonic
1117157035 14:52951263-52951285 GGCGTGGGGCGGGGCGGCGCGGG + Intronic
1118992604 14:70809612-70809634 GGCGCGGGGCGGGGCGGGCGTGG - Intergenic
1119004159 14:70908430-70908452 GACGAGGGCCGCGGCGGGGGCGG - Intronic
1120993600 14:90398267-90398289 GCCCTGGTGCGCGGGGGCCGGGG + Intronic
1122145175 14:99684517-99684539 CACCTGGGCCGCGGCGGCCCGGG - Exonic
1122231102 14:100306615-100306637 GAGGCGGGGCGCGGGGGACGTGG + Intergenic
1122516754 14:102314395-102314417 GACGGGGCGCGCCGGGGCCGGGG - Intergenic
1122558359 14:102593211-102593233 GGCGCGGGGCGCGGGGCCCGGGG - Intronic
1122688929 14:103522575-103522597 GCCGGGGGGCCCGGCGGCGGGGG - Intronic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1122853515 14:104548857-104548879 GAGGTGGGGAGCGGGGGCTGGGG - Intronic
1122978631 14:105181329-105181351 CGCGCGGGGCGGGGCGGCCGAGG + Intergenic
1123630757 15:22258245-22258267 GACCGGGGGCGCGCGGGCCGGGG - Intergenic
1123827909 15:24101648-24101670 CACGTGGGGCGTGAGGGCCGCGG + Intergenic
1123842368 15:24261059-24261081 CACGTGGGGCGTGAGGGCCGCGG + Intergenic
1123862028 15:24477650-24477672 CACGTGGGGCGTGAGGGCCGCGG + Intergenic
1124340186 15:28885589-28885611 CAAGCAGGGCGCGGCGGCCGGGG + Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124439222 15:29674887-29674909 GACTAGGGGCGAGGAGGCCGCGG - Intergenic
1124469192 15:29968513-29968535 GACGCGGGGCGCGCCGCGCGGGG - Intronic
1124779734 15:32618759-32618781 GACGTGGGGCGGGGGGGGGGGGG - Intronic
1125516611 15:40324316-40324338 GACTTCGGGGGCGGCGGCGGCGG + Intergenic
1128344044 15:66842603-66842625 GGCGGGCGGGGCGGCGGCCGGGG + Intergenic
1131094819 15:89648518-89648540 GGCCTGGGGCGCGCCGGCCGCGG + Exonic
1131144352 15:90001702-90001724 GGGGTGGGTCGCTGCGGCCGCGG + Intronic
1131144353 15:90001719-90001741 GGCGGGGGGCGGGTCGGCCGCGG - Intronic
1131389125 15:92032919-92032941 AAAGTGGGGCGGGGCGGGCGGGG + Intronic
1131977474 15:97960873-97960895 GGCTGGGTGCGCGGCGGCCGTGG + Exonic
1132527654 16:425714-425736 GACGGGGGCCGAGGAGGCCGGGG - Exonic
1132552930 16:560716-560738 GACGCGGGGCGCGGGGGCAGCGG + Intronic
1132741272 16:1414514-1414536 GCCGGGGGGCGCGGGGGCGGCGG + Intronic
1132757570 16:1493512-1493534 GTCCGGGGCCGCGGCGGCCGTGG + Exonic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1134419388 16:14071536-14071558 CGCGCGGGGCGGGGCGGCCGGGG + Intronic
1135382698 16:22008007-22008029 GAGCTGGGGCGCGGCGGCTGGGG + Intronic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136382062 16:29900400-29900422 CACGTGGGGCGCAGGGGCCACGG - Intronic
1137244690 16:46692863-46692885 GTCTTGGGGCGGGGCGGCGGTGG + Intronic
1137617679 16:49856873-49856895 GAGGGGGGAGGCGGCGGCCGCGG + Intronic
1138651701 16:58464517-58464539 GACTCCGGGCGCGGCGGCCGGGG + Intronic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1141531365 16:84648801-84648823 GAGTGGGGGCGCCGCGGCCGGGG + Intronic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141608644 16:85169438-85169460 CAAGTTGGGCGCGGCGGCGGCGG + Intergenic
1142136328 16:88453503-88453525 GGCGCGGGCCGGGGCGGCCGCGG + Exonic
1142144938 16:88489045-88489067 GATGTGGGGGGCGGCAGCGGTGG - Exonic
1142156486 16:88534762-88534784 GGCCTCGGGCGCGGCGGCCGGGG - Exonic
1142299402 16:89247684-89247706 AACGTGGGGCGCCGGGGGCGTGG + Intergenic
1142406186 16:89891497-89891519 CAGGTGGGGCGTGGCAGCCGCGG - Intronic
1203141971 16_KI270728v1_random:1772579-1772601 GAAGTGGGAAGAGGCGGCCGGGG - Intergenic
1142656689 17:1399521-1399543 CCCGTGTGGGGCGGCGGCCGTGG - Intronic
1142683417 17:1562921-1562943 GAGGTGGGGCCCCGCGGCTGGGG + Intergenic
1142854955 17:2724279-2724301 GAAGCGGGGCGAGGCGGCCCCGG - Intergenic
1143099838 17:4499007-4499029 GGCGGGGGGCGCGGGGGGCGCGG - Exonic
1143400646 17:6640197-6640219 GGCGGGGGGTTCGGCGGCCGTGG - Intronic
1143477648 17:7211782-7211804 GGCGGGGGCTGCGGCGGCCGCGG + Intronic
1143512648 17:7404932-7404954 GACGCGGGGCGGGCCGGCCCTGG + Intronic
1144269046 17:13600569-13600591 GAAGTGGGGCTCGGCGCCCACGG + Exonic
1145065708 17:19760015-19760037 GGCGTGGGGCGGGGCAGCCAAGG - Intergenic
1145214764 17:21043086-21043108 GGGGCGGGGCGCCGCGGCCGCGG + Intronic
1146022629 17:29292879-29292901 GACGGGGGGGGGGGCGGCCGCGG + Intronic
1146255992 17:31391801-31391823 GGCGGCGGGCGCGGCGGGCGAGG + Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1147879674 17:43645855-43645877 GCAGTGGGGCGCGGAGGCGGAGG - Intronic
1148081165 17:44968309-44968331 GAGGCGGGAGGCGGCGGCCGCGG - Intergenic
1148178077 17:45584874-45584896 GACGTGGGCAGCGGCAGCGGCGG + Intergenic
1148769051 17:50056457-50056479 GGCGTGGGGCGCGGGGCGCGCGG - Exonic
1148786835 17:50149729-50149751 GACGGGGCGGGCGGCGGCGGCGG + Exonic
1150249927 17:63699773-63699795 GCCGAGGGGCGGGGCGGGCGGGG - Intronic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150643448 17:66964573-66964595 GACCCGGAGCGCGGCGGCGGCGG + Intergenic
1150675745 17:67245030-67245052 GACCCCGGGCGCGGCGGCCCCGG - Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1151660461 17:75515717-75515739 GGCGGGGGGCGCGGGGGCAGAGG + Intergenic
1151718907 17:75844778-75844800 GACGTGGGGCGGGGCGGGGTGGG + Intergenic
1152730358 17:81967005-81967027 CAGGCGGGGCGGGGCGGCCGAGG - Intergenic
1155928667 18:31684630-31684652 GAGGGGAGGCGCGGAGGCCGAGG + Exonic
1158434762 18:57428070-57428092 GCCCTGGGGCTTGGCGGCCGGGG + Intergenic
1158457686 18:57622211-57622233 GACGGGGTGCGCGGCGGTGGAGG + Intronic
1160511480 18:79455762-79455784 GCCGTGGGATGGGGCGGCCGTGG - Intronic
1160511487 18:79455778-79455800 GCCGTGGGATGGGGCGGCCGTGG - Intronic
1160536970 18:79599873-79599895 GACGTGGCTTGTGGCGGCCGTGG - Intergenic
1160707727 19:537214-537236 AAGGTGGGGCTGGGCGGCCGTGG - Intronic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160766586 19:811277-811299 CAGCTGGGGCGCGGCGGCCGCGG + Exonic
1160766920 19:812838-812860 GACCTGGCGCGCGGCTTCCGCGG - Exonic
1160882055 19:1325366-1325388 GCGGCGGGGGGCGGCGGCCGGGG + Intergenic
1160895820 19:1401401-1401423 CGCGTGGGGGGCGGCGCCCGCGG - Exonic
1160909639 19:1468725-1468747 GCGGTGTGGCGCGGGGGCCGGGG - Exonic
1160942153 19:1625429-1625451 GACGTCGGGCGCTCGGGCCGTGG - Intronic
1161001393 19:1912850-1912872 GGCCTGGGGGGCAGCGGCCGGGG - Exonic
1161215796 19:3094554-3094576 GCCGCGGCGGGCGGCGGCCGAGG + Exonic
1161234820 19:3192629-3192651 GTCCTGGGGCACGGCGGCCATGG - Exonic
1161347368 19:3775026-3775048 GGCGTGAGGCGCGGCGGGGGGGG + Intergenic
1161388204 19:4007948-4007970 GGCGGGGGGCGGGGAGGCCGGGG + Intronic
1161620111 19:5293189-5293211 GACGCGGGGAGCGGCTGCGGCGG - Intronic
1162802536 19:13118970-13118992 GAAGTGGGGCACGGCGGGTGTGG + Intronic
1163606962 19:18280945-18280967 GCCGGGGGGCGCGGAGCCCGTGG + Exonic
1164273916 19:23700255-23700277 GACGTCGGGCGCGGTGGCTCAGG + Intergenic
1165157715 19:33797989-33798011 GCCGCGGGGCGGGGTGGCCGCGG - Intronic
1165419989 19:35717919-35717941 GGGGCGGGGCGGGGCGGCCGCGG - Intergenic
1165420077 19:35718106-35718128 GGCGGGGGCCGCGGCGGACGGGG + Exonic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1165760695 19:38319790-38319812 GAGGTGGGGGGCGGCGACGGAGG - Intergenic
1165774244 19:38395546-38395568 GGCCTGGGGTGGGGCGGCCGCGG + Exonic
1167258291 19:48443654-48443676 GTGGTGGGGCGCGGCGGCGGCGG - Exonic
1167578529 19:50329085-50329107 GACGGGGGGCGGGGCGGGAGGGG + Exonic
1167649050 19:50719637-50719659 GAGGAGGGGCGCGGCGGCCGCGG - Intergenic
1168281573 19:55308757-55308779 GGCGTGGGTGGCGGGGGCCGTGG + Intronic
1168293865 19:55369617-55369639 GGCGGGGGGCGCGGGGGGCGCGG + Intronic
1168408127 19:56121182-56121204 GGAGTGCGGCGCGGCGGCCCCGG - Exonic
926310317 2:11670092-11670114 GAGCTGGGCCGCGGGGGCCGCGG + Exonic
929646918 2:43637336-43637358 GACATCGGGCGCTGCGGCCGGGG + Exonic
931274866 2:60735734-60735756 GACGAGGGGAGCGGCGGCCGCGG + Intergenic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
932566808 2:72916068-72916090 GAGGTGGGGAGGGGCGGCCAGGG - Intergenic
932625683 2:73293783-73293805 GGCGTGGAGCGCTGGGGCCGCGG + Intergenic
932700019 2:73985513-73985535 GGCGGCGGGCGCGGCGGGCGCGG + Intergenic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
934655918 2:96116766-96116788 GCGGAGGGGCCCGGCGGCCGGGG + Intergenic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
934966907 2:98731227-98731249 GGCGCGGGGCGCGGGGCCCGCGG - Intergenic
935301570 2:101697765-101697787 GGCGCGGGGCGCGGGCGCCGGGG + Intronic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936217986 2:110576880-110576902 GAGGGGGGGGGCGGCGGCGGCGG - Intronic
937907026 2:127057445-127057467 GAGCTGGGCCGCGGCGGCCGCGG + Intronic
938397904 2:130964156-130964178 GGCGTGGTGTGTGGCGGCCGCGG + Intronic
942241043 2:173964490-173964512 GACGTGGATAGCGGCGGCGGCGG - Exonic
944579062 2:201116578-201116600 GACGCGGGGCGCGGCGGCGCAGG - Intronic
947257744 2:228183722-228183744 GAAGTGGGGCGGGGCGGGGGGGG - Intergenic
947549751 2:231037760-231037782 GCCGGGCGGCGCGGCGGCAGAGG + Exonic
947818154 2:233051846-233051868 GGCCTGGGGCGTGGTGGCCGTGG + Intergenic
948098859 2:235358081-235358103 TGCGTGGGGCGCTGCAGCCGTGG - Intergenic
948479516 2:238240839-238240861 GAGGCGGGGCGCGGAGGACGAGG - Intergenic
948874696 2:240820348-240820370 GACGGGCGACGCGGCCGCCGCGG + Intergenic
949007171 2:241656291-241656313 GACGTGGGACGCGGGTGACGTGG - Intronic
1169059590 20:2652187-2652209 GACGTGGGGCGCAGGGTCTGGGG + Exonic
1169849577 20:10034988-10035010 CACGCAGGGCGCGGCTGCCGGGG - Intronic
1170756352 20:19210498-19210520 GGGGTGGGGCGGGGGGGCCGGGG - Intergenic
1174133211 20:48360164-48360186 GAGGTGGGGCGGGGCGGGGGCGG + Intergenic
1174607005 20:51768387-51768409 CGCGGGGGGCGCGGCGGCCAAGG - Exonic
1175210447 20:57350871-57350893 GACGGGGGGCGGGGGGGGCGGGG + Intergenic
1175847066 20:62064920-62064942 CACGGCGGGCGCGGCGGTCGGGG + Exonic
1176109387 20:63404539-63404561 GACACGGGGAGCGGTGGCCGGGG + Intergenic
1176178018 20:63737788-63737810 GAGGTGGGGGGCGGGGGGCGGGG - Intronic
1176201550 20:63863043-63863065 GACGCGGGGCGGGGCGGGGGGGG + Exonic
1176242130 20:64080036-64080058 GGGGCGGGGCGCGGCGGGCGGGG - Intergenic
1176550539 21:8219086-8219108 GAAGCGGGGCGCGCCGACCGGGG - Intergenic
1176556327 21:8255997-8256019 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
1176569469 21:8402127-8402149 GAAGCGGGGCGCGCCGACCGGGG - Intergenic
1176575266 21:8439039-8439061 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
1176577381 21:8446356-8446378 GAAGCGGGGCGCGCCGACCGGGG - Intergenic
1178407155 21:32334306-32334328 GCTGTGGGGCCCAGCGGCCGTGG - Exonic
1179603397 21:42496244-42496266 GACGCGGGACGCGGCGGTGGAGG - Exonic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1180086272 21:45509321-45509343 GACGTGGGGCCTGTCGGCGGGGG - Intronic
1180102121 21:45593264-45593286 GCCGTGGGGCGACGGGGCCGTGG - Intergenic
1181026921 22:20132000-20132022 GACCAGCAGCGCGGCGGCCGTGG - Exonic
1181277225 22:21694679-21694701 GAGGTGGGGCGTGGCGGCTGGGG + Intronic
1181813709 22:25421138-25421160 GGCGCGGCGGGCGGCGGCCGCGG + Intergenic
1182604043 22:31489724-31489746 GGGGAGGGGAGCGGCGGCCGAGG - Intronic
1183720184 22:39557896-39557918 GGCGCGGGGGGCGGCGGGCGGGG - Intergenic
1183788432 22:40045295-40045317 GACGTCCGGCGCGCGGGCCGGGG + Intronic
1184127802 22:42500385-42500407 GGGGTGGGGCGGGGCGGCCTAGG + Intergenic
1184127813 22:42500406-42500428 GGGGTGGGGCGGGGCGGCCTAGG + Intergenic
1184152947 22:42649143-42649165 GGGGTGGGGCGCGGCGGGCTGGG + Intronic
1184265302 22:43343137-43343159 GAGGTGGGGGGCGGCGGGCGCGG - Intronic
1184412250 22:44331946-44331968 GAAGTGGGCAGCGGCGGCGGCGG - Intergenic
1185064041 22:48621776-48621798 GAGGTGGGGAGTGGTGGCCGAGG + Intronic
1185255020 22:49827278-49827300 GAGGTCGGGCCGGGCGGCCGGGG - Intronic
1185413415 22:50697489-50697511 GGCGGGGCGCGGGGCGGCCGCGG + Intergenic
1203253317 22_KI270733v1_random:128094-128116 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
1203255438 22_KI270733v1_random:135429-135451 GAAGCGGGGCGCGCCGACCGGGG - Intergenic
1203261372 22_KI270733v1_random:173173-173195 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
951803471 3:26622745-26622767 GAGGAGGGGCGAGGCGGCTGGGG - Intergenic
952889165 3:38029544-38029566 GACGGGCGGCGCGGCGGGAGGGG + Intronic
953761340 3:45689517-45689539 GGCCTGAGGCGCGGCGGGCGGGG + Intronic
955239339 3:57165355-57165377 GGCGGTGGCCGCGGCGGCCGCGG + Exonic
956604962 3:71064886-71064908 GGCGTGGGGTCCGGCGGCCTCGG + Intronic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
956678183 3:71754283-71754305 GGCGCGGCGTGCGGCGGCCGCGG + Exonic
957078681 3:75619829-75619851 GGTGTGGGGCGAGGCGGCCGCGG - Intergenic
961551565 3:127672882-127672904 GCCGCGGGGCGGGGAGGCCGGGG + Intergenic
961551644 3:127673148-127673170 GACGGGCGGCTGGGCGGCCGCGG + Intronic
962919135 3:139935420-139935442 GGCGTGGGGAGCGGCAGCGGCGG + Exonic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
964571336 3:158110241-158110263 GGCCTGGGGAGCGGCAGCCGTGG + Intronic
965734854 3:171809825-171809847 GAGGTGGGGCGAGGGGGCCGGGG - Intronic
966696334 3:182793714-182793736 CCCGCGGGGCGCGGGGGCCGCGG - Exonic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966868555 3:184276003-184276025 GGCGGGGGGGGGGGCGGCCGCGG + Intronic
968084528 3:195868394-195868416 GGCGTGGGGTGCAGGGGCCGGGG + Exonic
968479033 4:825853-825875 GACCCGGGGAGCGGAGGCCGGGG + Intronic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
969021762 4:4143797-4143819 GGTGCGGGGCGAGGCGGCCGCGG - Intergenic
969052804 4:4385380-4385402 GACGGGGGGCGGGGCGGGGGGGG + Intronic
969344726 4:6563621-6563643 GGCGGCGGGCGCGGCGGGCGCGG + Intergenic
969413371 4:7043525-7043547 GGCCGGGGGCGCGGCGGCTGCGG + Exonic
969577484 4:8045094-8045116 GAAGGGGGGCCCGGTGGCCGTGG - Intronic
969791701 4:9497703-9497725 GGTGCGGGGCGAGGCGGCCGCGG + Intergenic
971244127 4:24913057-24913079 GAGGAGGGGCGCGGCCGCCGGGG + Intronic
971351804 4:25862603-25862625 GACGCGGGTGGGGGCGGCCGGGG - Intronic
972311878 4:37890419-37890441 AACATGGGGGGCGGGGGCCGGGG - Intergenic
978072621 4:104491548-104491570 GCCGATGCGCGCGGCGGCCGCGG + Exonic
978351519 4:107825023-107825045 GGCCTCGGGGGCGGCGGCCGCGG + Intronic
978515095 4:109560603-109560625 GACGTGGGTCACGGAGGCCTGGG + Intronic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
979685352 4:123505750-123505772 GAGGTGGTGCGCCGGGGCCGCGG + Intergenic
980990497 4:139735071-139735093 GACGCGCGGGGCGGGGGCCGCGG - Intronic
982573195 4:157076107-157076129 GCCGTGGCGCGCCGCGGTCGGGG - Exonic
983792239 4:171813050-171813072 GAGCCGGGGCGCGGCGGCTGCGG - Intronic
984699355 4:182808426-182808448 GAAGTGGGGAGGGGCGGCTGGGG - Intergenic
984992754 4:185396765-185396787 GAGCTGGGGCGCGGCTGCCAAGG + Exonic
985713867 5:1445271-1445293 GAAGTGGGGCGCAGGGGCGGGGG - Intronic
986330663 5:6714068-6714090 GGCGTGGGCCGCGGCGGCTCGGG + Intergenic
986740548 5:10701599-10701621 GACGGGGGGCGGGGGGGCAGTGG + Intronic
987132347 5:14871570-14871592 GGCCTCGGGCGCGGCGGCGGCGG + Exonic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
992004120 5:72461126-72461148 TACTTGGGGCGCGGGGGCTGCGG + Exonic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
994366925 5:98928184-98928206 CACGTGGGGAGCGGCGGGAGGGG - Intronic
995512455 5:112922341-112922363 GGAGGGGCGCGCGGCGGCCGAGG - Exonic
995725883 5:115179941-115179963 GGCGCGGGGCGCCGCGGCCTGGG - Intronic
997732599 5:136192178-136192200 GACGGGGCGCCCGGCGGCCGTGG + Intergenic
997899727 5:137753854-137753876 GGCATGGGGCGAGGCGGCCATGG + Exonic
998142971 5:139710128-139710150 AGCCTGGGGCGCGGCGGGCGGGG - Intergenic
998525722 5:142841576-142841598 GACCTGGGGCTCGGAGGCTGAGG - Intronic
998583484 5:143403749-143403771 GAGGGGCCGCGCGGCGGCCGCGG + Intronic
1000026624 5:157364187-157364209 GAGGTGGGGCGGGGTGGCGGGGG + Intronic
1002784920 6:393156-393178 AACCTGGAGGGCGGCGGCCGAGG + Exonic
1002888066 6:1312965-1312987 GGCGGAGGGCGCGGAGGCCGGGG + Exonic
1003042543 6:2701356-2701378 GCAGTGGGGCACGCCGGCCGAGG + Intronic
1003645380 6:7910146-7910168 GACGTGGCGCTCGGCGGCCGGGG - Intronic
1003871181 6:10404469-10404491 GCCGCGGGGCGGGGCGGGCGGGG + Intronic
1004426393 6:15510107-15510129 GACCTGGGGGGCGGGGGCTGTGG + Intronic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1004720651 6:18264903-18264925 GCGGAGGGGCGCGGCGGGCGCGG + Intergenic
1007644434 6:43369459-43369481 GAGGCGGCGCGCAGCGGCCGAGG - Intronic
1013391664 6:109691440-109691462 GATGATGGGGGCGGCGGCCGTGG - Exonic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1015965646 6:138693291-138693313 GGCGCTGGGCGCGGCAGCCGCGG - Intergenic
1016433166 6:144008487-144008509 GAGCTGGGGGTCGGCGGCCGAGG + Intronic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1018013610 6:159693353-159693375 GGGGTTGGGCGCGGCGGGCGCGG - Intronic
1018942599 6:168319454-168319476 GCCGCAGGGCGCGGCGGGCGCGG + Exonic
1019298330 7:290560-290582 GCCGTGGGGCGCAGAGGCGGAGG - Intergenic
1019404649 7:877129-877151 GACGAGGCGGGAGGCGGCCGAGG - Intronic
1020023593 7:4883497-4883519 GACCTGGGGCGCGGAGGCCGCGG - Intronic
1020106248 7:5423539-5423561 GCGGAGGGGAGCGGCGGCCGCGG - Exonic
1020125538 7:5530864-5530886 AGCGTGGGGCGCGGGGGCCACGG - Intronic
1020309180 7:6855827-6855849 GGTGCGGGGCGAGGCGGCCGCGG - Intergenic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029417202 7:100450677-100450699 GTGGTCGGGCGTGGCGGCCGCGG - Intergenic
1029436857 7:100568495-100568517 GGTGTGGGGCGGGGGGGCCGTGG - Intergenic
1029490103 7:100866263-100866285 GGTGTGGGGCGAGGGGGCCGGGG + Exonic
1029640233 7:101815816-101815838 GCCCCAGGGCGCGGCGGCCGCGG - Intergenic
1031966835 7:128032714-128032736 GACTCGGGGGACGGCGGCCGGGG + Intronic
1032021662 7:128409986-128410008 GAGGAGGGGCGGGGCCGCCGGGG + Exonic
1034192811 7:149224596-149224618 GCCGTGGGGCGCCGGGGCCCGGG - Exonic
1034349211 7:150405505-150405527 GCGGGGGGGCGCTGCGGCCGTGG + Intronic
1034522609 7:151632266-151632288 GACGCGGGCAGCGGGGGCCGGGG + Intronic
1034977797 7:155458242-155458264 GAGGGCGTGCGCGGCGGCCGCGG - Exonic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1035341626 7:158166308-158166330 GACAGGGAACGCGGCGGCCGGGG - Intronic
1035341683 7:158166515-158166537 GACAGGGAACGCGGCGGCCGGGG - Intronic
1035629795 8:1098607-1098629 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629808 8:1098644-1098666 GGCGTGGGTGGCGGCGTCCGTGG - Intergenic
1035629822 8:1098681-1098703 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629836 8:1098718-1098740 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629850 8:1098755-1098777 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037879535 8:22566080-22566102 GACCGGGGTCGCGGCCGCCGGGG + Intronic
1038304157 8:26383613-26383635 GACGTGCGGCGGGGACGCCGGGG + Intronic
1038828544 8:31033165-31033187 GAGGCGGGGGGCGGCGGCTGCGG - Exonic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1043502943 8:80874262-80874284 GCGGGGCGGCGCGGCGGCCGCGG + Intronic
1044692656 8:94895397-94895419 GCCGTGGAGCGCGGTGGACGCGG - Intronic
1045098851 8:98825730-98825752 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098863 8:98825750-98825772 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098875 8:98825770-98825792 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098887 8:98825790-98825812 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098899 8:98825810-98825832 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098911 8:98825830-98825852 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045098923 8:98825850-98825872 GGGGCGGGGCGGGGCGGCCGGGG - Intronic
1045231403 8:100310159-100310181 GCGCTGGGGCGGGGCGGCCGGGG - Intronic
1048981172 8:139703920-139703942 GGCGGCGGGCGCGGCGGCGGCGG + Intergenic
1049542718 8:143215757-143215779 GTCCTGGGGCGTGGCAGCCGAGG - Intergenic
1050472576 9:6008130-6008152 GGGGTGGGGCGCCGAGGCCGCGG - Intergenic
1051483023 9:17579398-17579420 GAGGCGGGGCGCGGCCGGCGCGG - Intronic
1052888824 9:33676951-33676973 CACGGGGGGTGCGGCGGCGGCGG + Intergenic
1053003370 9:34589877-34589899 GTCGTGGCGCGCGGCCGCGGAGG - Intronic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1056475303 9:86946824-86946846 GGCGCGGGGAGCGGCGGACGCGG + Exonic
1056930131 9:90867352-90867374 TACCTGGGGCGCGGCTGCCCAGG - Intronic
1057466385 9:95317774-95317796 TCCGTGGGGCGGGGCGGGCGCGG + Intergenic
1057570984 9:96204123-96204145 GATGTGGGGAGCGGCCGCCCCGG + Intergenic
1057623309 9:96655343-96655365 GAGGTTGGGCGCGGGGGGCGGGG + Intergenic
1059417875 9:114173147-114173169 GAGTTGGGGCGGGGAGGCCGTGG + Intronic
1059633933 9:116154328-116154350 GCGGCGAGGCGCGGCGGCCGCGG - Exonic
1059942257 9:119369532-119369554 GAATGGGGGAGCGGCGGCCGGGG + Intergenic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1060897312 9:127225796-127225818 CGCGAGGGGCGCGGGGGCCGCGG - Intronic
1061052251 9:128203738-128203760 GGTGGGGGGCGCGCCGGCCGCGG - Intronic
1061365989 9:130172641-130172663 GGCGGGGGCCGCGGCCGCCGAGG + Exonic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1061843917 9:133376214-133376236 GGCGTCGAGCGCGGCGGGCGTGG - Intergenic
1061889224 9:133608951-133608973 GACCTGGTGCGAGGCAGCCGGGG + Intergenic
1062158914 9:135069151-135069173 GAGGTGGGGCGTGGCTGCAGGGG + Intergenic
1062272285 9:135714966-135714988 GACTTGGGGCGCGGAGGCGGAGG + Intronic
1062332297 9:136050042-136050064 GACGTAGGGGGCCGCGGCGGCGG + Exonic
1203469717 Un_GL000220v1:111241-111263 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
1203471834 Un_GL000220v1:118564-118586 GAAGCGGGGCGCGCCGACCGGGG - Intergenic
1203477538 Un_GL000220v1:155213-155235 GACGTGGGTGTCGGCGGGCGCGG + Intergenic
1187900906 X:24025749-24025771 GACGCGGGGCGCCGCGGGCGCGG - Intronic
1189197232 X:39162560-39162582 CACGTGGCGCGCCGGGGCCGCGG + Intergenic
1190007995 X:46758646-46758668 CAGGAGGAGCGCGGCGGCCGAGG + Intronic
1190126823 X:47712972-47712994 GACCAGGGGCGGGGAGGCCGGGG + Intergenic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1195252668 X:103063837-103063859 CACGGGGGGCGAGGCGGCCGAGG - Intronic
1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG + Exonic
1196833050 X:119791355-119791377 GACGGGCTGCGCTGCGGCCGCGG - Intronic
1197774464 X:130110527-130110549 GACGGCGGCCCCGGCGGCCGCGG - Intronic
1197831230 X:130645691-130645713 GATGTGGGGCGCGGCTGCTGGGG - Intronic
1200151731 X:153954535-153954557 GACTTGGGTCACGGTGGCCGAGG + Exonic
1200229467 X:154436948-154436970 GGCGCGGGGCGGGGCGGGCGGGG - Exonic