ID: 1102914357

View in Genome Browser
Species Human (GRCh38)
Location 12:116741899-116741921
Sequence CCCAGGGCTTTGAGAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16517
Summary {0: 1, 1: 3, 2: 52, 3: 1123, 4: 15338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102914357_1102914363 9 Left 1102914357 12:116741899-116741921 CCTTGATCTCTCAAAGCCCTGGG 0: 1
1: 3
2: 52
3: 1123
4: 15338
Right 1102914363 12:116741931-116741953 GTGAACCACTGCACCTGGCATGG 0: 2
1: 33
2: 580
3: 2245
4: 5808
1102914357_1102914362 4 Left 1102914357 12:116741899-116741921 CCTTGATCTCTCAAAGCCCTGGG 0: 1
1: 3
2: 52
3: 1123
4: 15338
Right 1102914362 12:116741926-116741948 TAGGTGTGAACCACTGCACCTGG 0: 45
1: 975
2: 9000
3: 32049
4: 80151
1102914357_1102914364 10 Left 1102914357 12:116741899-116741921 CCTTGATCTCTCAAAGCCCTGGG 0: 1
1: 3
2: 52
3: 1123
4: 15338
Right 1102914364 12:116741932-116741954 TGAACCACTGCACCTGGCATGGG 0: 1
1: 11
2: 264
3: 1085
4: 3099
1102914357_1102914366 15 Left 1102914357 12:116741899-116741921 CCTTGATCTCTCAAAGCCCTGGG 0: 1
1: 3
2: 52
3: 1123
4: 15338
Right 1102914366 12:116741937-116741959 CACTGCACCTGGCATGGGTTAGG 0: 1
1: 3
2: 7
3: 90
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102914357 Original CRISPR CCCAGGGCTTTGAGAGATCA AGG (reversed) Intronic
Too many off-targets to display for this crispr