ID: 1102915730

View in Genome Browser
Species Human (GRCh38)
Location 12:116750378-116750400
Sequence GGGCTCCTCCTCTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 490}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102915717_1102915730 24 Left 1102915717 12:116750331-116750353 CCTAGCCATGGGCTTCACAGGCA 0: 1
1: 0
2: 2
3: 25
4: 208
Right 1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 490
1102915719_1102915730 19 Left 1102915719 12:116750336-116750358 CCATGGGCTTCACAGGCAGGCTG 0: 1
1: 0
2: 2
3: 41
4: 305
Right 1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 490
1102915728_1102915730 -4 Left 1102915728 12:116750359-116750381 CCTGCAGCCGGTGGGGTGGGGGC 0: 1
1: 0
2: 5
3: 44
4: 454
Right 1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102915730 Original CRISPR GGGCTCCTCCTCTGAAGCCC AGG Intronic
900097645 1:946558-946580 GGGGTCAGCCACTGAAGCCCAGG + Intronic
900438408 1:2642018-2642040 GGGCAGCTCCTGTGCAGCCCAGG - Intronic
900456765 1:2778673-2778695 GGGTGCCTCCTCTGATCCCCAGG + Intronic
900467340 1:2832247-2832269 GGGCTCCTCCTCTCACGACTGGG + Intergenic
900497071 1:2980639-2980661 GGGCTCCCCCACTGCAGGCCAGG - Intergenic
900586910 1:3437032-3437054 GGGTTCCTCCTCTGTGGGCCTGG + Exonic
900643717 1:3699253-3699275 GCTCTCTTCCTCCGAAGCCCAGG + Intronic
900720148 1:4170669-4170691 GAGCTCCTGCTCTCAAGCCACGG - Intergenic
901103642 1:6738337-6738359 GGGCTCCAGCTCTGTTGCCCTGG + Intergenic
901106009 1:6757132-6757154 AGGCTCTTCCTCTGTTGCCCAGG - Intergenic
901513108 1:9727828-9727850 GGGGTCTTCCTCTGTTGCCCAGG + Exonic
901588237 1:10316524-10316546 GGTCTCTTGCTCTGTAGCCCAGG + Intronic
901651632 1:10746521-10746543 GGGGCCCTCATCTGAAGCCATGG - Intronic
902616249 1:17625102-17625124 GGGTTCCTCCACTGAGGCCGTGG - Intronic
902973603 1:20072780-20072802 AGGCACCTCCTCTTAGGCCCAGG + Intronic
902980500 1:20119357-20119379 GGGCTGCTGCTCTGATCCCCAGG - Intronic
903185206 1:21624935-21624957 GGGCTCCTCCTGAGATGCTCAGG + Intronic
903280921 1:22249339-22249361 GGGCTCCTGCTTTGCAGCCCAGG + Intergenic
903831177 1:26176138-26176160 GGGCTCCTGCTATGTTGCCCAGG + Intergenic
903882815 1:26523286-26523308 GGGTCCCTCTTCTGAAGCCTGGG - Intergenic
904173580 1:28609510-28609532 GGGCTACTGCTCTGTCGCCCAGG + Intronic
904365597 1:30009167-30009189 AGGCTCCTCCTCTGATTCTCTGG - Intergenic
904440158 1:30524868-30524890 TGGCTCCTCCTTTGAAATCCAGG - Intergenic
905612467 1:39366357-39366379 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
905899214 1:41570048-41570070 GGACTTCTCCTCTGAACTCCGGG - Intronic
906996303 1:50797657-50797679 AGGCTCTTGCTCTGTAGCCCAGG - Intronic
907464924 1:54628567-54628589 GGGGTCTTGCTCTGATGCCCAGG - Intronic
908219183 1:61986444-61986466 GGGGTCTTCCTCTGTAGCCCAGG + Intronic
909630056 1:77761340-77761362 AGGGTCCTCCTCTGTTGCCCAGG - Intergenic
909876725 1:80814707-80814729 GGGCTCTTCCTATGTAGCCCTGG - Intergenic
912314607 1:108656509-108656531 GGGCTCTTTCTCTGTTGCCCAGG + Intronic
912371950 1:109180478-109180500 GGGGTCCTGTTCTGATGCCCAGG - Intronic
915238216 1:154501637-154501659 GGGCTCCTCCTCCGTGGCCCGGG + Exonic
916713106 1:167429547-167429569 GGGGTCCTCCTGTGTTGCCCAGG + Intergenic
917752146 1:178063440-178063462 GGGGTCTTGCTCTGTAGCCCAGG - Intergenic
918061514 1:181065418-181065440 GGAGTCTTCCTCTGTAGCCCAGG - Intergenic
918220295 1:182430532-182430554 GGCCACCTCCTCTGATGCACAGG - Intergenic
918676768 1:187296322-187296344 GGAGTCCTCCTCTGTCGCCCAGG + Intergenic
921152677 1:212414556-212414578 GGGCCGCTCCTCTGCACCCCGGG + Intronic
922380216 1:225015832-225015854 GGTATCCACCTCTGGAGCCCAGG - Intronic
922456398 1:225777158-225777180 AGCGTCTTCCTCTGAAGCCCAGG + Intergenic
922847611 1:228700893-228700915 GGGGTCCTGCTCTGTTGCCCAGG - Intergenic
922995810 1:229959761-229959783 GGGCTCTTGCTCTTATGCCCAGG - Intergenic
923497015 1:234534569-234534591 GGGCCCCTCCCCTGAAGGGCGGG - Intergenic
923621169 1:235580774-235580796 GGGGTCTTCCTCTGTTGCCCAGG + Intronic
923652264 1:235884816-235884838 AGGGTCTTGCTCTGAAGCCCAGG + Intergenic
923994065 1:239471693-239471715 GGTCTCTTCCTCTGAGGCCTTGG - Intronic
924237627 1:242012449-242012471 AGTCTGCTGCTCTGAAGCCCTGG + Intergenic
1062874079 10:931465-931487 GGGCTCCTCGCCTCAACCCCGGG + Exonic
1063720281 10:8573786-8573808 GGAGTCCTCCTCTGTCGCCCTGG + Intergenic
1064284704 10:13982290-13982312 GGGGTCCTCCTATGTTGCCCAGG - Intronic
1065849482 10:29775399-29775421 AGGCTCTTGCTCTGTAGCCCAGG + Intergenic
1066624217 10:37390100-37390122 AGGGTCCTCCTCTGTTGCCCAGG + Intergenic
1067414434 10:46092693-46092715 GGGCTCCTCCCAGGAAGGCCAGG - Intergenic
1067434499 10:46267239-46267261 GGGCTCCTCCCAGGAAGGCCAGG - Intergenic
1067439207 10:46299106-46299128 GGGCTCCTCCCAGGAAGGCCAGG + Intronic
1067762561 10:49059022-49059044 GTGCTCTGCCTCTGTAGCCCAGG - Intronic
1067774132 10:49149706-49149728 TGGATCCTCCTTTGAAGCCAAGG + Intergenic
1068606701 10:59013028-59013050 GTGCTTCACCTCTGAAGTCCAGG - Intergenic
1069945276 10:71981332-71981354 AGCCTCCTCCTCTGTAGCCTTGG + Intronic
1072529363 10:96304353-96304375 GGGCAGCACCTGTGAAGCCCTGG + Intergenic
1073378652 10:103059942-103059964 GGGATCTTGCTCTGTAGCCCAGG - Intronic
1073876273 10:107925917-107925939 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1074872970 10:117591857-117591879 GGGCTCCACCTCTGCAGACCCGG - Intergenic
1074934063 10:118160063-118160085 GGGGTCTTGCTCTGAAGCCCAGG - Intergenic
1076563020 10:131379789-131379811 AGGCCACTCCTCCGAAGCCCAGG + Intergenic
1076569777 10:131425076-131425098 ACGCCCCTCCTCTGAATCCCTGG + Intergenic
1076624888 10:131815764-131815786 GGGCACCTCCTGTGAATGCCTGG - Intergenic
1077305054 11:1865211-1865233 GAGTTCCTCCTCAGAAGCCCGGG - Exonic
1078725307 11:13924816-13924838 GGGATCCTTCTCTGAGCCCCAGG + Intergenic
1079027748 11:16962103-16962125 TGCCTCCTCATCTGAAGCACAGG - Intronic
1079393859 11:20044876-20044898 GCTCTCCTCCTCTGAAGAGCTGG - Intronic
1079737352 11:24013315-24013337 GGGCTCCTCCACTGTGGCCTGGG - Intergenic
1083150437 11:60788677-60788699 GAGCTCAGCTTCTGAAGCCCAGG + Intronic
1083186590 11:61021439-61021461 GGGCTGCTCCACAGCAGCCCTGG + Intergenic
1083812424 11:65113076-65113098 GGGGTGATCCTCTGAAGGCCAGG + Intronic
1084560598 11:69903512-69903534 GGCCTCCTCCAGGGAAGCCCAGG + Intergenic
1084615724 11:70234561-70234583 GGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1084951904 11:72671112-72671134 TGTCTCTTCCTCTGAAGCCCAGG + Intronic
1085102421 11:73812687-73812709 GGGATCCTGCTCTGTCGCCCAGG - Intronic
1085519807 11:77131212-77131234 TGGCTCCTGCTCTGGAGGCCAGG - Intronic
1085567569 11:77528383-77528405 GGGGTCTTCCTCTGTTGCCCAGG + Intronic
1086359286 11:86040391-86040413 GGTCTCCCCCTCTGTTGCCCAGG + Intronic
1088290382 11:108230721-108230743 AGGCTCTTGCTCTGTAGCCCAGG + Intronic
1088598209 11:111455401-111455423 GGCCTTCTCTTCTGCAGCCCAGG - Intronic
1088658222 11:112021951-112021973 GGGGTCCTGCTCTGTAGCCTAGG - Intronic
1089172804 11:116527228-116527250 GGGGTCCTCCTATGTTGCCCAGG - Intergenic
1089286268 11:117409873-117409895 GGGCCCCTGCCCTGAATCCCAGG - Exonic
1089432569 11:118436299-118436321 GGCCTCCGCCTCTGACGCCTGGG - Intergenic
1089531215 11:119131112-119131134 AGGCTCTTGATCTGAAGCCCAGG + Intronic
1089599388 11:119604250-119604272 GGTGTCCACCTCTGAACCCCGGG - Intergenic
1090185460 11:124736655-124736677 GGGCTCCTCCTCTGCCAACCAGG + Intergenic
1090224437 11:125061686-125061708 GGACAGCACCTCTGAAGCCCTGG + Intergenic
1090339225 11:126001381-126001403 GGTCTCCCCCTCTGTTGCCCAGG + Intronic
1090996365 11:131869308-131869330 GGACTCCTCCTCTGAAACAATGG - Intronic
1091335551 11:134763010-134763032 CGGCTTCTCCCCTGAAGGCCTGG - Intergenic
1091736188 12:2923953-2923975 GGGGTCCTGCTCTGTAACCCAGG - Intronic
1092201622 12:6587866-6587888 GCGCTCCTCCACTGACGCACGGG + Exonic
1093039741 12:14364622-14364644 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1097733007 12:63150916-63150938 GGGCTCCTCGTCCGAAGCGCAGG + Exonic
1098096522 12:66962551-66962573 GGGCACCCCCTATGAAGCCACGG + Intergenic
1098393463 12:69993657-69993679 TGGTTCTTCCTCTGAAGCCTGGG + Intergenic
1098434829 12:70457628-70457650 GGGGTCCTGCTCTGTTGCCCAGG - Intergenic
1098680119 12:73343553-73343575 AGGCATCTCCTCTGATGCCCAGG + Intergenic
1099410740 12:82323458-82323480 GGGGTCTTGCTCTGTAGCCCAGG + Intronic
1101321514 12:103677027-103677049 AGGCTCCTCCTGAGAGGCCCGGG + Intronic
1101808178 12:108083266-108083288 GGCCTCCTCCCCTGCAGCCCAGG + Intergenic
1102908074 12:116692640-116692662 GGGTTCCCCCTCTGTTGCCCAGG - Intergenic
1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG + Intronic
1103281387 12:119760599-119760621 GGGGTTTTGCTCTGAAGCCCAGG - Intronic
1103295592 12:119883900-119883922 AGGCTCCTGCTCTGTTGCCCAGG - Intergenic
1103562058 12:121797986-121798008 TGGCTCCTCCTGTGAGGGCCAGG - Intronic
1103596577 12:122027809-122027831 GGACTCCTGCTCTGTGGCCCAGG - Intronic
1104417499 12:128607317-128607339 AGGCTCAGCCTCAGAAGCCCTGG + Intronic
1104516796 12:129434562-129434584 GGGAGCCTCCTCTGCAGCCCTGG - Intronic
1104856005 12:131902824-131902846 GGTTTCCTCCCCTGGAGCCCAGG + Intronic
1104889451 12:132133190-132133212 GGGCTCCTCCTGCGGAGACCGGG + Intergenic
1105327845 13:19386470-19386492 GGGCCCCTCTGCTGAGGCCCTGG - Intergenic
1105661820 13:22504280-22504302 GGACTCTCCCTCTGTAGCCCAGG + Intergenic
1106413046 13:29524378-29524400 GGACTCAGCGTCTGAAGCCCAGG - Intronic
1107046009 13:35992945-35992967 AAGCTACTGCTCTGAAGCCCTGG + Intronic
1108824670 13:54398016-54398038 GGGGTCTTGCTCTGATGCCCAGG - Intergenic
1110718839 13:78738632-78738654 GGGGTCTTCCTCTGTTGCCCAGG - Intergenic
1111210590 13:85073550-85073572 AGGATCCTGCTCTGAAGCCCAGG + Intergenic
1111292133 13:86184706-86184728 GGGCTCCACCCCTGCAGCCCTGG + Intergenic
1111762555 13:92483906-92483928 GGCCTCCTCCTCTTGAGGCCAGG + Intronic
1111990434 13:95110940-95110962 AGGGTCTTGCTCTGAAGCCCAGG - Intronic
1112368820 13:98777103-98777125 AGGCTCTTGCTCTGTAGCCCAGG + Intergenic
1112726030 13:102305926-102305948 TGGCTTCTCTTTTGAAGCCCTGG + Intronic
1113081288 13:106523073-106523095 CTGACCCTCCTCTGAAGCCCAGG - Intronic
1113462052 13:110489036-110489058 GGGCTCTTGCTCTGTTGCCCAGG - Intronic
1113607963 13:111623742-111623764 GAGCTTCTCCTAAGAAGCCCAGG + Intronic
1113722853 13:112573838-112573860 GGGCTGCTCCTCTGCATCCCGGG - Intronic
1113730278 13:112636758-112636780 TGGCTCCTCCTCTGTAACACGGG - Intergenic
1114080801 14:19200390-19200412 GGGCAGCCCCTCTGCAGCCCAGG - Intergenic
1114579486 14:23744509-23744531 AGACTCCACCTCTGAAGGCCGGG - Intergenic
1115689838 14:35831129-35831151 GGGGTCTTCCTCTGTTGCCCAGG + Intronic
1116955047 14:50914723-50914745 TGGCTCCTACTCTGCAACCCAGG - Exonic
1117168628 14:53067182-53067204 GGGCTCTCCCTCTGTGGCCCAGG + Intronic
1117329555 14:54698820-54698842 TTGTTCCTCCTCTGAATCCCAGG + Intronic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1119542930 14:75452480-75452502 GGGCTTGTCCTCAGAAGCCTGGG - Intronic
1119877956 14:78076578-78076600 GGGCTCCTGCTATGTTGCCCAGG + Intergenic
1121056826 14:90862491-90862513 AGGCTCCTGCTCTGTTGCCCAGG + Exonic
1122075608 14:99232810-99232832 GGGCTCTTTCTCTGTAGCCCTGG + Intronic
1122228277 14:100292236-100292258 GGGCTCCTTCTCAGAAACCTGGG - Exonic
1122261604 14:100526416-100526438 GGGCCCCTGCTCTGAACTCCTGG - Intronic
1122417077 14:101555095-101555117 GGCCTCCTCCACTCAAGCACTGG - Intergenic
1122678880 14:103440908-103440930 GGGCTCCTGCTCTGTTACCCTGG - Intronic
1122692148 14:103536499-103536521 GGGCCCCTCCTCTGTGCCCCAGG - Exonic
1122893827 14:104745506-104745528 GGCTTCCTCCTCAGCAGCCCTGG + Intronic
1124156154 15:27226600-27226622 CGGTGGCTCCTCTGAAGCCCGGG - Intronic
1125526774 15:40381374-40381396 GGGGTCCTGCTATGATGCCCAGG - Intergenic
1126049828 15:44675648-44675670 CAGCTCCTCCTCAGAAGCCAAGG + Exonic
1127045225 15:55018151-55018173 GGGGTCTTACTCTGCAGCCCAGG + Intergenic
1127403459 15:58615246-58615268 GGACTCTTGCTCTGTAGCCCAGG - Intronic
1127908262 15:63393537-63393559 GGGGTCCCCCTCTGCTGCCCAGG - Intergenic
1129005098 15:72366332-72366354 GGAGTCCTCCTCTGTTGCCCAGG + Intronic
1129594173 15:76946724-76946746 GGGGTCTTGCTCTGTAGCCCAGG - Intronic
1129687580 15:77695504-77695526 GGGCTCATCCCCAGATGCCCAGG + Intronic
1129742024 15:77993927-77993949 GGGCTCCTCCTCTGAGGATGGGG - Intronic
1129823267 15:78618890-78618912 GTGCTCAGCCTCTGAGGCCCTGG + Exonic
1130956404 15:88630246-88630268 TGGCTCCTCCTCTGCTGCCGTGG - Exonic
1131009843 15:89008087-89008109 CTGCTCTTCCTCTGAAGTCCTGG + Intergenic
1131462498 15:92628188-92628210 GGGGTCTTCCTCTGTTGCCCAGG + Intronic
1132148071 15:99440294-99440316 TGGCTCCTCCGCTCAAGACCTGG + Intergenic
1133099440 16:3470290-3470312 GGGCTTCTCCAGGGAAGCCCAGG + Intronic
1133105956 16:3509617-3509639 GGTCTCCTGCTCTGAGGCCTTGG - Intronic
1133209614 16:4256226-4256248 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1133222218 16:4323643-4323665 GGGCATCTCCTAGGAAGCCCGGG + Intronic
1133446495 16:5865553-5865575 GAGCTCCTCATCTGATGCCTTGG + Intergenic
1134560995 16:15209560-15209582 GGACTCTTCCTCTGTCGCCCAGG + Intergenic
1134921532 16:18121184-18121206 GGACTCTTCCTCTGTCGCCCAGG + Intergenic
1135588440 16:23688930-23688952 AGGGTCCTGCTCTGTAGCCCAGG + Intronic
1135844792 16:25909212-25909234 GGGCTCTTGCTCTGCAGCCCAGG + Intronic
1136102748 16:28007705-28007727 GGGGTCCTCCTATGTTGCCCAGG + Intronic
1136418784 16:30119341-30119363 GGGCTCTTGCTCTGTTGCCCAGG + Intronic
1136553729 16:30995983-30996005 GGGGTCTTCCTCTGTTGCCCAGG - Intronic
1136683936 16:31983319-31983341 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1136784563 16:32926871-32926893 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1136885220 16:33926935-33926957 GGCCTCCTCCTCTGGGGGCCTGG - Intergenic
1137351568 16:47718258-47718280 GGGTTCCTGCTCTGGGGCCCAGG + Intergenic
1137729429 16:50679184-50679206 GGGCTCTTGGTCTGAACCCCTGG + Intronic
1137834736 16:51580671-51580693 GAGCTCCTACTCTGAAACCATGG - Intergenic
1138676774 16:58657008-58657030 AGTCTCCTCCTCTGAAAGCCGGG - Intergenic
1138839576 16:60483896-60483918 GGAGTCTTGCTCTGAAGCCCGGG + Intergenic
1139551625 16:67676320-67676342 GGGGTCCTCCTCTGTTGCCTAGG + Intronic
1140086759 16:71803896-71803918 GGAGTCCTCCTCTGTTGCCCAGG - Intronic
1141982773 16:87560579-87560601 TGGCTCCTCCTCCAAAACCCTGG - Intergenic
1142263909 16:89054833-89054855 GAGCTCCTCCGCCGAAGCCCTGG + Intergenic
1142281122 16:89148128-89148150 GGGGTCTTGCTCTGATGCCCAGG + Intronic
1142377100 16:89711843-89711865 GGGCTCCTCCTACAAAGCCTGGG + Intronic
1203087222 16_KI270728v1_random:1190877-1190899 GGCCTCCTCCTCTGGGGGCCTGG + Intergenic
1142506792 17:369452-369474 TGACTTCTCATCTGAAGCCCTGG - Intronic
1142651065 17:1352548-1352570 GGAGTCTTCCTCTGTAGCCCAGG + Intronic
1142918189 17:3161049-3161071 AGGATCCTCCCCTGGAGCCCTGG + Intergenic
1143129757 17:4670692-4670714 GGACTCCTGCTCTGTCGCCCAGG - Intergenic
1144251124 17:13417730-13417752 GGGATCCTGCCCTGAAGCCAAGG - Intergenic
1144702373 17:17347975-17347997 GGGACCCTGCTCTGAAGCACTGG - Intergenic
1145967951 17:28934019-28934041 GGGGTCTTGCTTTGAAGCCCAGG - Intronic
1146261602 17:31425790-31425812 GGGCTCCCCCTCTGGCTCCCAGG - Intronic
1147300114 17:39519613-39519635 GGGCTCTTGCTCTGTTGCCCAGG + Intronic
1147475122 17:40703552-40703574 TGGCTCCTCCTCGGAAGCCCTGG + Exonic
1147477015 17:40721791-40721813 CGGCTCCTCTTTGGAAGCCCCGG + Intergenic
1148215162 17:45830277-45830299 GGGCTCCTCCTCTGCAGGGCAGG - Intronic
1148805030 17:50259673-50259695 GGGCTCTTCCTCTGGGTCCCAGG + Intergenic
1148832803 17:50445773-50445795 GGGGTCTTGCTCTGAAGCCTAGG - Intronic
1151596119 17:75078860-75078882 GGGCTCCTCTGAGGAAGCCCTGG + Intergenic
1151666152 17:75546185-75546207 GGGCTCCCCCTCCCAAGGCCTGG - Intronic
1151713876 17:75821725-75821747 TGGGTCCTTCTCGGAAGCCCGGG + Intronic
1152104742 17:78322519-78322541 GGTCTCATCCCCTAAAGCCCTGG - Intergenic
1152251424 17:79214608-79214630 GGGCTCCTCCTCTCTCTCCCTGG - Intronic
1152283212 17:79397465-79397487 GGAGTCCTCCTCTGTTGCCCAGG - Intronic
1152380622 17:79940806-79940828 GGGGACCTCCTCAGAGGCCCTGG - Exonic
1152562044 17:81083487-81083509 CGGCCCCTCCTCTGCAGACCAGG + Intronic
1152756770 17:82090294-82090316 GGGGTCCTCACCTGCAGCCCTGG - Intronic
1153305560 18:3627684-3627706 GGGGTCTTCCTCTGTTGCCCAGG + Intronic
1153531307 18:6049092-6049114 GGGGTCTTCCTCTGTTGCCCAGG - Intronic
1153926385 18:9838785-9838807 GGGAGCCTCCTCTGAGTCCCAGG - Intronic
1154388700 18:13918354-13918376 GGGCTCTCCCTCTGTTGCCCAGG + Intergenic
1155119291 18:22802088-22802110 GGGGTCTTCCTCTGTTGCCCAGG - Intronic
1157601062 18:48893540-48893562 GGTCCCCTCCTCTTGAGCCCCGG - Intergenic
1158077561 18:53548349-53548371 CTACTCCTCCTCTGAAGCCCAGG + Intergenic
1158398036 18:57094988-57095010 GGCCTTCTCCTCTGGATCCCAGG - Intergenic
1158991116 18:62869911-62869933 GGGCTCTTGCTCTGTCGCCCAGG + Intronic
1159931290 18:74315527-74315549 GAGCTCCGGCGCTGAAGCCCCGG - Intergenic
1160498033 18:79386571-79386593 GTTCTCTTCCTCTGAAGCCGGGG - Intergenic
1160859220 19:1230665-1230687 GGGCAACTTCCCTGAAGCCCAGG - Exonic
1160977049 19:1797828-1797850 GGGGTCCTACTCTGTGGCCCAGG + Intronic
1161055288 19:2187965-2187987 GGGCTGCTCCTCTGGAGCTGCGG + Intronic
1161575502 19:5052394-5052416 GGGCTGGTCCCCTGCAGCCCTGG - Intronic
1161578707 19:5068760-5068782 GGGCTGCTCCTCTGAACGCTGGG + Intronic
1162164711 19:8744377-8744399 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162165782 19:8751845-8751867 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162166848 19:8759301-8759323 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162167914 19:8766761-8766783 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162168853 19:8773055-8773077 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162170599 19:8785823-8785845 GGGCTCCACCTCTGAGTCGCAGG - Intergenic
1162312107 19:9913815-9913837 GGGCTCCTCTTATAAAGCGCCGG + Intronic
1162666319 19:12215902-12215924 GGACTCTTGCTCTGTAGCCCAGG - Intergenic
1162815014 19:13188667-13188689 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1162843462 19:13373181-13373203 GGGGTCTTGCTCTGATGCCCAGG + Intronic
1163363193 19:16860939-16860961 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
1163669043 19:18617068-18617090 AGGCTCCCACCCTGAAGCCCTGG + Exonic
1163707499 19:18823751-18823773 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1163764712 19:19156675-19156697 GGGGTCTTCCTCTGTCGCCCAGG + Intronic
1164547593 19:29181939-29181961 CTGCTCCTCCTTTGAGGCCCTGG - Intergenic
1164627866 19:29741354-29741376 TGCCTCCTCCTCTGACTCCCTGG + Intergenic
1164630039 19:29756014-29756036 GGGCTCCCTCTCTGAACACCTGG + Intergenic
1164722082 19:30439740-30439762 GGTCAGCTCCTCTGAAACCCTGG + Intronic
1165032222 19:33006386-33006408 GGGGTCCTCCTGTGTGGCCCAGG + Intronic
1165072748 19:33265030-33265052 GGCCTCCTGCACTGCAGCCCTGG + Intergenic
1165112236 19:33509212-33509234 GGGCTGCCCCTCGGAGGCCCTGG - Intronic
1165230231 19:34382134-34382156 GGGCTCTGACTGTGAAGCCCAGG + Intronic
1165886629 19:39083871-39083893 TGACCCCTCCTCAGAAGCCCGGG - Intergenic
1166523745 19:43498144-43498166 GGGCTCCCCCTATGTTGCCCAGG - Intronic
1166544180 19:43624267-43624289 GGGATCGTCCTCTGATGACCTGG - Intronic
1166864542 19:45827940-45827962 GGCCTCTTCCTCTGCAGCCATGG - Intronic
1167001905 19:46750459-46750481 GGTCTCCGCTTCTGAGGCCCTGG - Intronic
1167152076 19:47716095-47716117 GGGGTCTTACTCTGTAGCCCAGG + Intronic
1167295179 19:48645537-48645559 GGGCTCCTCCCGGGAACCCCAGG + Intronic
1167649495 19:50721639-50721661 GGTCTCCTCCTTTGAAGAGCAGG + Intergenic
1167898868 19:52603262-52603284 GGGCTCTGGCTCTGTAGCCCAGG + Intronic
1168328282 19:55549934-55549956 GAGCTCCTCCACTGGAGACCCGG + Intergenic
1168548247 19:57271713-57271735 GGGGTCTTCCTCTGTAACCCAGG - Intergenic
1168631651 19:57961207-57961229 GGACTCTTACTCTGTAGCCCAGG - Intronic
925033378 2:669051-669073 TGGCTTCTCCTGTGGAGCCCGGG - Exonic
926751625 2:16202844-16202866 GGGATCCTCCTGTGAAGGCCTGG + Intergenic
927019375 2:19000966-19000988 GGGGCCCTCCTTTGAAGCCCTGG - Intergenic
927493211 2:23534173-23534195 GGTCTCATGATCTGAAGCCCCGG - Intronic
928297435 2:30096666-30096688 GGGCACCTCCTCTGAGCCCAGGG + Intergenic
929105399 2:38360309-38360331 GGGGTCTTGCTCTGATGCCCAGG + Intronic
930599625 2:53428100-53428122 GGGATCCTGCTCTGTCGCCCAGG - Intergenic
931345487 2:61441478-61441500 GGAGGCCTCCTCTGGAGCCCAGG + Intronic
931694093 2:64859375-64859397 AGGCTCCTCCTCTGGAGCTAGGG + Intergenic
932040053 2:68290052-68290074 AGGAGTCTCCTCTGAAGCCCAGG + Intronic
932042994 2:68319562-68319584 GAGCTGCTCCTCAAAAGCCCGGG - Exonic
932127531 2:69157390-69157412 GGGCTGGTCCTCTGGAGCCAAGG - Intronic
933782235 2:85810824-85810846 GGGCACCTTATCTGCAGCCCAGG + Intergenic
934052052 2:88219410-88219432 GGCCTCCTCCACACAAGCCCAGG + Intergenic
935179434 2:100676721-100676743 GGGCTCTTCCACTGCAGCCTGGG + Intergenic
935990226 2:108712705-108712727 GCGGCTCTCCTCTGAAGCCCTGG - Intergenic
936558224 2:113514351-113514373 GGGCTTCTCCTCTGCACCCTTGG - Intergenic
937216281 2:120315602-120315624 GGGCACCTCCTCTGTGTCCCTGG + Intergenic
938265890 2:129927970-129927992 GGGCTCCTCTCCTAAACCCCTGG - Intergenic
938311510 2:130292161-130292183 GGGGTCTTCCTCTGTTGCCCAGG + Intergenic
939344102 2:140940576-140940598 GGGAACTTCCTCTAAAGCCCAGG - Intronic
940194877 2:151082583-151082605 AGGGTCCTGCTCTGTAGCCCAGG - Intergenic
940918714 2:159285678-159285700 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
943303439 2:186230872-186230894 AGGCTCCACCTCTGAAGGCAGGG + Intergenic
943757225 2:191569344-191569366 GGGCTCTTGCTCTGTTGCCCAGG + Intergenic
944804525 2:203267816-203267838 GGACTCTTGCTCTGTAGCCCAGG - Intronic
945091270 2:206178237-206178259 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
945594303 2:211772973-211772995 GGGGTCCTACTCTGTTGCCCAGG + Intronic
946163010 2:217847547-217847569 TGGCTCCTCCTCTGGAGTCCGGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948264550 2:236627417-236627439 CGGTTCCTCCTCAGCAGCCCAGG + Intergenic
948264971 2:236629392-236629414 GGGCTCCCTCTCTGGAGACCAGG + Intergenic
948577511 2:238964266-238964288 GGTCTCCTCCTCTGAGGACCTGG + Intergenic
948633129 2:239314840-239314862 GGACCCCTCCTCTCAAGCCAAGG + Intronic
949083847 2:242130273-242130295 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1168785070 20:531769-531791 GGTCTCATACTCTGAAGCCTAGG - Intronic
1169021812 20:2336078-2336100 AGGCTCCTTCTCAGGAGCCCAGG + Intronic
1171464279 20:25316899-25316921 GTCCTCCTCCTCTGTTGCCCAGG - Intronic
1171865977 20:30487990-30488012 GGGCTCATCCTCGCAAGTCCCGG - Intergenic
1172081213 20:32342267-32342289 GGAGTCCTCCTCTGTTGCCCAGG - Intergenic
1174394428 20:50237848-50237870 GGGCTCTCCCTCTGCTGCCCAGG + Intergenic
1175388106 20:58610216-58610238 CGGCCCCTCCTCTGGAGCCCAGG - Intergenic
1175407716 20:58745589-58745611 GGGCTCCTCCTCAGGGGCCTGGG + Intergenic
1175470341 20:59222801-59222823 GGGCACCTGCTCTGAACACCAGG + Intronic
1175722714 20:61297020-61297042 GAACTGCTCCTCTGAAGCTCAGG - Intronic
1176036694 20:63043074-63043096 GAGCTCCTCCCCAGGAGCCCAGG - Intergenic
1177797314 21:25792652-25792674 GGGGTCTTCCTATGATGCCCAGG + Intergenic
1178426420 21:32482530-32482552 GGGTACCTCCTCGGAAGCCCAGG + Intronic
1179394022 21:41021613-41021635 GGGGTCCTACTCTGACACCCAGG + Intergenic
1180499972 22:15922295-15922317 GGGCAGCCCCTCTGCAGCCCAGG + Intergenic
1180931426 22:19594774-19594796 GGGCTCCTGCTATGCTGCCCAGG - Intergenic
1181098162 22:20520381-20520403 GGGTTCGTCCTCAGAAGCCTCGG + Intronic
1181113739 22:20618135-20618157 GGGCTCTCACTCTGTAGCCCAGG + Intergenic
1181167672 22:20992242-20992264 GGGCACCTCCTCGGAAGCACAGG - Exonic
1181660371 22:24342645-24342667 GGAGTCCTGCTCTGTAGCCCAGG - Intronic
1181734043 22:24868249-24868271 GGGATCCTGCTCTGAGGCTCTGG - Intronic
1182518763 22:30873447-30873469 GGGCCCCTCCTGGGAAGCCAGGG + Intronic
1182555180 22:31125302-31125324 GGGCTGCTCCTCAGAAGCCAGGG - Exonic
1182930817 22:34172634-34172656 GGAATCCTGCTCTGTAGCCCAGG - Intergenic
1183891740 22:40935349-40935371 GGAGTCCCCCTCTGTAGCCCAGG - Intergenic
1184240671 22:43209910-43209932 GGGCTGGTCCTCTGAGCCCCAGG + Intronic
1185005536 22:48274480-48274502 AGGCTCCTCCTATGTTGCCCAGG - Intergenic
1185082408 22:48717341-48717363 GGGCTCCTCCTGGGATGTCCAGG - Intronic
1185222552 22:49636298-49636320 AGCCTCCTCCTCTGCACCCCAGG + Intronic
1185251740 22:49805595-49805617 GGGCTCCTCCTCTGCAGGCTGGG + Intronic
950043371 3:9934010-9934032 GGGCTCCTCCCTCCAAGCCCGGG + Intronic
950333564 3:12176205-12176227 GGGCTGCTCCTCAGACTCCCAGG + Intronic
950776682 3:15356331-15356353 AGGCTGCTCCTCTCCAGCCCAGG - Intergenic
953392793 3:42543571-42543593 GGGCTCCTCTTCTCAGCCCCAGG - Intergenic
953658355 3:44871809-44871831 GGGATCCTCTCCTGATGCCCAGG + Intronic
954350238 3:50037206-50037228 GGGGTCTTCCTATGATGCCCCGG - Intronic
954416185 3:50394572-50394594 GGGCCCCTCCTGTGGAGCTCTGG - Intronic
954862111 3:53699530-53699552 GGGCTCTTCGTCTGAAGACCTGG - Intronic
955721657 3:61888357-61888379 GGGCTCTTCCTCTGTCGCCCAGG + Intronic
956137094 3:66110084-66110106 GGGGTCTTCCTCTGTTGCCCAGG - Intergenic
956137671 3:66115056-66115078 AGGGTCTTCCTCTGTAGCCCAGG + Intergenic
956212688 3:66818044-66818066 GGTCTCCTCCTAGGAAGCCTGGG + Intergenic
958040274 3:88219190-88219212 GAGCTCCTCCTTTTCAGCCCTGG + Intergenic
959011694 3:101085206-101085228 GGGTTCCTGCTATGTAGCCCAGG - Intergenic
961371622 3:126435083-126435105 GGGCTTCTCCTCTGGGTCCCTGG + Intronic
961392014 3:126557888-126557910 GGCCTCCGCCCCTGCAGCCCTGG + Intronic
961536175 3:127572343-127572365 GGGCTCCTCCTCTCCAACTCTGG + Intergenic
962790176 3:138804320-138804342 GGGCTCTTGCTCTGTTGCCCAGG - Intronic
964358309 3:155870437-155870459 GGGCTCCTCCTCCCAAGGGCGGG + Intergenic
964488091 3:157206396-157206418 GGTCTCCTGCTCTGTAACCCAGG - Intergenic
964610321 3:158607203-158607225 GGACTCCTGCTCTGTTGCCCAGG - Intronic
964777513 3:160294242-160294264 AGGGTCCTGCTCTGATGCCCAGG + Intronic
965368164 3:167825019-167825041 AGGCTCTTGCTCTGATGCCCAGG - Intronic
965528726 3:169749230-169749252 CTGCTGCTCCTGTGAAGCCCTGG + Intergenic
965734109 3:171802905-171802927 GGGCTCTTGCTCTCCAGCCCTGG - Intronic
967043254 3:185713724-185713746 GGACTCCTGCTCTGTTGCCCAGG + Intronic
967172391 3:186831901-186831923 GGGTTCCTCCTGTGAAGCGTGGG - Intergenic
967216152 3:187212313-187212335 GGGCACCTCCTCTAAACCACAGG - Intergenic
967732613 3:192919713-192919735 AGGGTCTTCCTCTGTAGCCCAGG + Intergenic
967803527 3:193691193-193691215 GGGGTCCTACTCTGTCGCCCAGG - Intronic
967975495 3:195032109-195032131 GGTCTCCTCATCTGAAACACAGG + Intergenic
968572523 4:1349520-1349542 CAGCTGCTCCTCTGAAGACCTGG - Exonic
968645491 4:1738475-1738497 GGCCCCCTCCTCTGCAGGCCTGG + Intronic
971200885 4:24508191-24508213 CTGCTCCTCCTGGGAAGCCCAGG + Intergenic
971456712 4:26852012-26852034 GGGCTTTTCCTCTGAATTCCTGG + Intergenic
971756867 4:30718235-30718257 TGGCTCCTCCTCCGAGGCCAGGG - Intergenic
972329364 4:38050216-38050238 AGTCTCCCCATCTGAAGCCCTGG + Intronic
972448948 4:39176902-39176924 GTGGTCTTGCTCTGAAGCCCAGG - Intergenic
973338943 4:48985252-48985274 GGAGTCCTGCTCTGTAGCCCAGG - Intergenic
975672718 4:76798043-76798065 GGGCTCTTGCTATGATGCCCAGG + Intergenic
976075808 4:81298115-81298137 GGGCTCCACCCCTGCACCCCTGG - Intergenic
976195524 4:82528318-82528340 GGGCCCCACCTCTGAAGTTCTGG + Intronic
980311906 4:131141922-131141944 GGAGTCTTGCTCTGAAGCCCAGG - Intergenic
981712301 4:147721375-147721397 GGAGTCTTGCTCTGAAGCCCAGG - Intergenic
984881605 4:184414365-184414387 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
985201769 4:187491318-187491340 GGACTCCTCCTCCCAAGTCCCGG - Intergenic
985943458 5:3157658-3157680 GGGGTCTTGCTCTGATGCCCCGG - Intergenic
986812347 5:11373597-11373619 GGGCCCCTCCCCTGAGGTCCTGG - Intronic
989085243 5:37669436-37669458 GGGGTCTTGCTCTGTAGCCCAGG + Intronic
989748401 5:44860402-44860424 GGGCTACTCCTCTGAAAGCCAGG - Intergenic
990609442 5:57442568-57442590 GAGCTGCTCCTCCCAAGCCCTGG - Intergenic
990627701 5:57633096-57633118 CAGCTACTCCTCTGAAGCACTGG - Intergenic
992087512 5:73291188-73291210 GGGAGCCTCCTCAGAAGCCCTGG - Intergenic
992177341 5:74163359-74163381 GGGTTCTTGCTCTGATGCCCAGG + Intergenic
992223866 5:74599479-74599501 GGGCTCTTGCTCTGTTGCCCAGG - Intergenic
992472073 5:77067722-77067744 GGATGCCTCCTTTGAAGCCCTGG + Intergenic
995414941 5:111899320-111899342 GGGATCCTTCTATGTAGCCCAGG - Intronic
995608805 5:113887914-113887936 AGGCTCTTGCTCTGAAGCCAGGG - Intergenic
996898300 5:128512485-128512507 GGGTTCCTGCTCTGTTGCCCAGG - Intronic
996988618 5:129600893-129600915 GGGGTCTCCCTCTGTAGCCCAGG + Intronic
997424507 5:133794094-133794116 GGGCTGCACCTCTGGAGCTCCGG + Intergenic
997803660 5:136891602-136891624 GGCTTCCTCCTTTGAAGCCCTGG + Intergenic
998491680 5:142552052-142552074 GGGCTCCTGCTCTCCAGCCCAGG - Intergenic
999137247 5:149330251-149330273 AGGATCCTCTTCTGAAACCCAGG + Intronic
999151424 5:149428828-149428850 GGGCTCCACCTCTCCAGCTCTGG - Intergenic
1000334411 5:160231417-160231439 GGAGTCCTGCTCTGTAGCCCAGG + Intronic
1000803668 5:165760627-165760649 GGGAGCCTCCTCTGCTGCCCAGG - Intergenic
1001400997 5:171446369-171446391 GGGCCTCTCCCCTGGAGCCCAGG + Intronic
1001791555 5:174461884-174461906 AGACTCCTACTCTGAAGTCCAGG - Intergenic
1002101808 5:176861563-176861585 GGCCTCCCAGTCTGAAGCCCTGG + Intronic
1002443456 5:179275950-179275972 GGCCTCTTCCCCAGAAGCCCAGG - Intronic
1002599515 5:180346341-180346363 GGGCATCTCCTCAGAAGCCAGGG - Intronic
1002925595 6:1604405-1604427 GGCCTCCTTCTCTGGAGACCCGG + Intergenic
1003418914 6:5938438-5938460 GGGCTCCTCCGCTGAAGCCTGGG - Intergenic
1003569503 6:7246898-7246920 GGGCCCCTCCTCTGCAGTGCTGG - Exonic
1003767241 6:9252885-9252907 TGGGTCCTCCGCTGAGGCCCTGG + Intergenic
1004988820 6:21113912-21113934 GGGCTCTTGCTCTGTTGCCCAGG - Intronic
1005986971 6:30881695-30881717 AGTCTCCTCCTCTGAGCCCCTGG + Intronic
1007217544 6:40251994-40252016 TGCCTCCTCCTCAGCAGCCCTGG - Intergenic
1007550173 6:42723023-42723045 GGGGTCTTCCTATGTAGCCCAGG - Intergenic
1007724912 6:43909855-43909877 GTCCTTCTCCTCTGCAGCCCTGG + Intergenic
1008808006 6:55455079-55455101 GGGGTCTCACTCTGAAGCCCAGG - Intronic
1008887093 6:56443381-56443403 GTTCTCCTCCTCACAAGCCCTGG - Intergenic
1010230554 6:73530936-73530958 GGGCTCTCCCTCTGTTGCCCAGG + Intergenic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1012885546 6:104842111-104842133 GGGGTCCTGCTTTGATGCCCAGG - Intronic
1013075344 6:106765942-106765964 TGGCTGCTCCTCTGAAGTTCAGG - Intergenic
1014159466 6:118151538-118151560 GGGGTCTTGCTCTGTAGCCCAGG + Intronic
1015785872 6:136921669-136921691 GGGTTCCTCCTCCGATGCCCGGG + Intergenic
1017012692 6:150073355-150073377 GGGGTCTTCCTCTGTTGCCCAGG + Intergenic
1017072484 6:150587985-150588007 GGGCTTCTTCTGTGAAGGCCAGG + Intergenic
1018782358 6:167079716-167079738 CATATCCTCCTCTGAAGCCCAGG - Intergenic
1018804882 6:167250750-167250772 GCGGTCATCCTCTGAAGCCTTGG - Intergenic
1018896421 6:168021371-168021393 GAGCTTCTCCTCTGAAGCAGCGG - Intronic
1019168779 6:170117019-170117041 GGGCTCCTTCCCTTCAGCCCAGG - Intergenic
1019520365 7:1458168-1458190 GGGCTCCTCCCCTGTGCCCCTGG - Intronic
1019740743 7:2671678-2671700 GGGCTCCTCCTCTCGGCCCCTGG - Intergenic
1019799194 7:3075583-3075605 GCACTCCTGCTCTGCAGCCCCGG - Intergenic
1019807897 7:3142019-3142041 GGGCCCTTCCTCTGTTGCCCAGG - Intronic
1020050870 7:5080745-5080767 GGGACCCTCCTCTGCATCCCCGG + Intergenic
1020681106 7:11237810-11237832 GGACTCCTGCTCTGTTGCCCTGG + Intergenic
1021383879 7:20003885-20003907 GAGATTCTCCTCCGAAGCCCAGG + Intergenic
1022722967 7:32957396-32957418 GGGCTCCTCCCCTGGAGCTGCGG + Exonic
1022974030 7:35540787-35540809 GGGGTCTTGCTCTGTAGCCCAGG - Intergenic
1023257400 7:38325623-38325645 GGGCTTGCCCTCTCAAGCCCTGG + Intergenic
1023676133 7:42632148-42632170 GGGCTCCTCCATTGAAGGCGGGG + Intergenic
1024318433 7:48042884-48042906 AGGCTCCTTCTCAGAGGCCCAGG - Intronic
1024881281 7:54088163-54088185 GGGGTCTTCCTCTGTAGCCCAGG + Intergenic
1025195289 7:56927780-56927802 GGGCTCTTGCTCTGCTGCCCAGG + Intergenic
1025676663 7:63649163-63649185 GGGCTCTTGCTCTGCTGCCCAGG - Intergenic
1026017289 7:66681593-66681615 GGGCTCTCCCTCTGTGGCCCAGG + Intronic
1026026511 7:66749025-66749047 GACTTCCTCCACTGAAGCCCTGG + Intronic
1026164630 7:67899060-67899082 GGGGTCTTACTCTGTAGCCCAGG + Intergenic
1026321066 7:69267950-69267972 AGGGTCCTGCTCTGTAGCCCAGG + Intergenic
1026941358 7:74289663-74289685 GGCCTCCTCCTCTCGGGCCCGGG - Exonic
1027847385 7:83398916-83398938 GGGGTCCTGCTCTGTTGCCCAGG - Intronic
1027997916 7:85449646-85449668 GGCCTCTTGCTCTGTAGCCCAGG - Intergenic
1028385970 7:90253638-90253660 CGCCTCCTCCTCTCAAGCGCTGG + Intronic
1029131239 7:98332882-98332904 GGGCTCTACCTCTTAACCCCGGG - Intronic
1029248612 7:99220369-99220391 GGGCTCCTGCTCCCCAGCCCTGG + Intergenic
1029256267 7:99271723-99271745 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1029384405 7:100234098-100234120 GGGCTCCTCCTCAGCAACTCTGG + Intronic
1029424624 7:100488194-100488216 AGGTTCCTCCGCAGAAGCCCAGG + Exonic
1029707060 7:102281757-102281779 GGGCCCTTTCTGTGAAGCCCAGG + Intronic
1030161333 7:106511312-106511334 CGGCTCCTACTCTGTGGCCCCGG - Intergenic
1032708609 7:134443385-134443407 GGGCTCCTACTCTGTCACCCAGG - Intronic
1034674404 7:152882247-152882269 GGGCCTCCCCTCTGAGGCCCTGG + Intergenic
1035020549 7:155797664-155797686 GCTCTCCTCCTCTCCAGCCCTGG - Intergenic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035460752 7:159037105-159037127 GTGATCCTCCTCTGGAGCCGCGG - Intronic
1035471070 7:159109271-159109293 AGGCTCCTCCTCTGCACCCAGGG - Intronic
1035662629 8:1359384-1359406 ACTGTCCTCCTCTGAAGCCCAGG - Intergenic
1036205080 8:6799657-6799679 GGACTCTTGCTCTGAGGCCCAGG + Intergenic
1036697290 8:10984963-10984985 GGGGTCCTGCTCTGTACCCCAGG + Intronic
1037424191 8:18737350-18737372 GGGGTCTTACTCTGTAGCCCAGG + Intronic
1037812178 8:22093471-22093493 CGGCTCCTTCTATCAAGCCCTGG - Intronic
1038875201 8:31540912-31540934 TGGCTCCTCCTCAGATGTCCAGG + Intergenic
1039845717 8:41324161-41324183 GGGCTCCTCATCAGAACCCCAGG - Intergenic
1039962238 8:42257740-42257762 GGTCTCCTCCTATGCTGCCCAGG - Intergenic
1040276269 8:46015669-46015691 GGCCTCCTCCTCGGCAGCACAGG + Intergenic
1040303569 8:46200625-46200647 GGTATCCTGCTCTGAAGCCAGGG - Intergenic
1040587920 8:48761974-48761996 AGGGTCTTCCTCTGTAGCCCTGG + Intergenic
1040727836 8:50404811-50404833 GCTCTCCTCCTCTTAACCCCTGG + Intronic
1041189402 8:55338378-55338400 TGGCTCCTACTCTGGTGCCCTGG - Intronic
1041404209 8:57479992-57480014 GGGCTCTTGCTCTGTTGCCCAGG + Intergenic
1042734045 8:71968002-71968024 TGGCTCCTCATCTGTAGCACAGG + Intronic
1043422342 8:80111184-80111206 AGGCTCTTGCTCTGTAGCCCAGG - Intronic
1045468597 8:102491166-102491188 GGGCTACTGCTCTGTTGCCCAGG + Intergenic
1045903402 8:107312644-107312666 GGGCTTCTCCTCTGAATACAGGG + Intronic
1046974174 8:120254964-120254986 GGGGTCTTGCTCTGTAGCCCAGG - Intronic
1047022842 8:120794783-120794805 TGGTTCCTTCTCTAAAGCCCTGG - Intronic
1048111567 8:131473565-131473587 GGCTTCCACCTCTGAAGCCGTGG - Intergenic
1048421227 8:134280161-134280183 AGGCTCCTCATCTGCAACCCAGG + Intergenic
1048432516 8:134383416-134383438 GGACTCCTCCTCTGCAGCTGGGG - Intergenic
1048469534 8:134695137-134695159 GAGCTCCTCCACTGCAGCCTGGG - Intronic
1049014926 8:139913640-139913662 TGCCTTCTCCTCTGCAGCCCTGG + Intronic
1049158845 8:141084545-141084567 TGGCTCCGGCTCTGAAGTCCCGG - Intergenic
1049216929 8:141412546-141412568 TGGCTCCTCCTCGGGACCCCTGG - Intronic
1049656856 8:143802816-143802838 GGGCTTCTGCTCTGGAGTCCAGG + Intronic
1049894637 9:101915-101937 GGGCTTCTCCTCTGCACCCTTGG + Intergenic
1050709373 9:8442947-8442969 GGGGTCTTCCTCTGTTGCCCAGG - Intronic
1051265744 9:15307040-15307062 GGGCCCGGCCCCTGAAGCCCTGG - Intronic
1051833514 9:21308568-21308590 GTCCTCCTCCTCTAATGCCCTGG - Intergenic
1052921976 9:33978341-33978363 GGGCTCTTGCTCTGTTGCCCAGG - Intronic
1053073757 9:35116003-35116025 GAGCTCCTCCCCTGTAGCCCGGG + Intronic
1053735843 9:41101905-41101927 GGGCTTCTCCTCTGCACCCTTGG + Intergenic
1054356369 9:64067131-64067153 GAGCTCCTCCTCTGAGGACAGGG - Intergenic
1054692531 9:68329493-68329515 GGGCTTCTCCTCTGCACCCTTGG - Intronic
1056135204 9:83623663-83623685 GGCCTCCTCCTATGAGGCCCTGG + Intronic
1056519173 9:87384434-87384456 AGGCTCTTGCTCTGTAGCCCAGG + Intergenic
1057200421 9:93136904-93136926 GGGCTCCTCCACAGAGGCCTGGG - Intergenic
1057304309 9:93903482-93903504 GGGCTGCTCCCCAGAAGCCTAGG - Intergenic
1057720590 9:97528726-97528748 CTGCTCCTGCTCTGAAGCCGTGG - Intronic
1057832292 9:98416685-98416707 GGGCTTCTCCTCTGAGCTCCTGG + Intronic
1059040954 9:110815062-110815084 GGGGTCCTCCTATGTTGCCCAGG - Intergenic
1059129309 9:111729139-111729161 ATGGTCCTCCTCTGTAGCCCAGG + Intronic
1059313034 9:113401375-113401397 GGGCTCCTCCGCTCCAGCCGCGG + Intergenic
1059396618 9:114038190-114038212 GCACTCCTCCTCTGAATCCTCGG + Intronic
1060408399 9:123383947-123383969 TTGCTCCTCCCCTGAAGGCCTGG - Intronic
1060833159 9:126732583-126732605 GGTCTCCTGCTCTGCCGCCCAGG + Intergenic
1061186329 9:129056542-129056564 GGACTCCTGCTCTGTTGCCCAGG + Intronic
1061701461 9:132419395-132419417 GGGCTGCTTCTCTGACGCCACGG - Intronic
1061777455 9:132975066-132975088 GGGGTCTTGCTCTGTAGCCCAGG - Exonic
1062002200 9:134221988-134222010 GGGACCCTCCTCTGTGGCCCTGG + Intergenic
1062086377 9:134651095-134651117 TGGCTCCCCTTCTGAAGCACTGG - Intronic
1062200455 9:135300139-135300161 GGACAGCTCCTCTGATGCCCAGG + Intergenic
1062339882 9:136089268-136089290 TGGGTCCTCCTTTGAGGCCCTGG - Intronic
1186031632 X:5375388-5375410 GGGGTCTTCCTCTGTTGCCCAGG + Intergenic
1186480914 X:9895537-9895559 GGGCTGCTCCGCGGGAGCCCAGG + Exonic
1186574587 X:10751603-10751625 GGTCTCCTCCTCTGTCACCCAGG - Intronic
1187274161 X:17803983-17804005 GGAGTCCTGCTCTGCAGCCCAGG + Intronic
1187639667 X:21274245-21274267 GGGCTGCCCCTCTGAAGCCAGGG + Intergenic
1189309179 X:40008193-40008215 GGGTTCCTCCTAGGAGGCCCAGG + Intergenic
1189833217 X:44996100-44996122 AGGGTCTTCCTCTGTAGCCCAGG + Intronic
1190234838 X:48607391-48607413 GGGGTCTTGCTCTGACGCCCAGG + Exonic
1195082876 X:101387375-101387397 AGGGTCTTGCTCTGAAGCCCAGG + Intronic
1195648646 X:107261629-107261651 GGGCTCTTGCTATGATGCCCAGG + Intergenic
1195709334 X:107761377-107761399 GGGCTCCTGCTCAAAGGCCCTGG + Intronic
1195892591 X:109712122-109712144 GGGGTCCTGCTCTGTTGCCCAGG + Intronic
1196397350 X:115279135-115279157 GGGATCTTGCTCTGTAGCCCAGG + Intergenic
1199660373 X:150043847-150043869 GGGGTCTTGCTCTGTAGCCCAGG + Intergenic
1199991490 X:152989962-152989984 GGGGTCCCCATCTGAAGCCCAGG + Exonic
1200000764 X:153058727-153058749 GGGGTCCCCATCTGAGGCCCAGG - Intronic
1201899351 Y:19032509-19032531 AGGGTCTTCCTCTGATGCCCAGG + Intergenic