ID: 1102923602

View in Genome Browser
Species Human (GRCh38)
Location 12:116810601-116810623
Sequence CACATACCCATGATGTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102923602_1102923609 5 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923609 12:116810629-116810651 AACCCCTGCTGTGGGGTGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 211
1102923602_1102923607 -2 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923607 12:116810622-116810644 TGGTGGCAACCCCTGCTGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 177
1102923602_1102923616 28 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923616 12:116810652-116810674 GGAATTAATCATCAAGCTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 163
1102923602_1102923605 -4 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923605 12:116810620-116810642 TGTGGTGGCAACCCCTGCTGTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1102923602_1102923608 4 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923608 12:116810628-116810650 CAACCCCTGCTGTGGGGTGCTGG 0: 1
1: 0
2: 2
3: 24
4: 326
1102923602_1102923612 7 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923612 12:116810631-116810653 CCCCTGCTGTGGGGTGCTGGGGG 0: 1
1: 0
2: 2
3: 41
4: 474
1102923602_1102923610 6 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923610 12:116810630-116810652 ACCCCTGCTGTGGGGTGCTGGGG 0: 1
1: 0
2: 1
3: 38
4: 383
1102923602_1102923615 27 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923615 12:116810651-116810673 GGGAATTAATCATCAAGCTAAGG 0: 1
1: 0
2: 1
3: 5
4: 114
1102923602_1102923606 -3 Left 1102923602 12:116810601-116810623 CCAAACTACATCATGGGTATGTG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1102923606 12:116810621-116810643 GTGGTGGCAACCCCTGCTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102923602 Original CRISPR CACATACCCATGATGTAGTT TGG (reversed) Intronic
903323436 1:22555905-22555927 CACATAGTCATGAGATAGTTGGG - Intergenic
905838953 1:41156991-41157013 CAGATACCCAGGATGGAGTGTGG + Intronic
907481061 1:54745774-54745796 CACAGACCCTGGATGTAGATGGG - Intergenic
919361429 1:196600524-196600546 CAAAAACTAATGATGTAGTTTGG + Intronic
921261923 1:213392133-213392155 GTCCCACCCATGATGTAGTTGGG + Intergenic
923232490 1:232000041-232000063 CACATGCCCAAGATATAATTAGG + Intronic
1071343840 10:84672672-84672694 GACATAGCCATGAAGTGGTTGGG - Intergenic
1073937794 10:108655001-108655023 CAGATACCCATAAGGTAGATAGG - Intergenic
1077844166 11:6006645-6006667 CTCATAGCTATGATATAGTTAGG + Intergenic
1081535052 11:43990172-43990194 CACAAACCAATGAAGTAGGTAGG - Intergenic
1082195807 11:49303823-49303845 CAGAAACTCATGATCTAGTTTGG - Intergenic
1085331378 11:75654753-75654775 CACAGAGTCATGATGAAGTTGGG - Intronic
1085365244 11:75935760-75935782 CAAATATCCATGATTTATTTTGG - Intronic
1085429857 11:76438492-76438514 CACATACTCATAATCTAGTGGGG - Intergenic
1085706833 11:78794153-78794175 CACATAAACATGAAATAGTTGGG - Intronic
1085992730 11:81869888-81869910 CACAAGCCCAGGATGTGGTTTGG - Intergenic
1086650992 11:89290037-89290059 AACAAACACATGAAGTAGTTAGG - Intronic
1086660031 11:89404413-89404435 CAGAAACTCATGATCTAGTTTGG + Intronic
1086798840 11:91144964-91144986 CATATATCAATGATATAGTTTGG - Intergenic
1087390692 11:97528684-97528706 CACATACACATTATGCTGTTTGG + Intergenic
1087691480 11:101325678-101325700 CCCACCCCAATGATGTAGTTGGG - Intergenic
1088080763 11:105909572-105909594 CACATACCCAGTATGGAGTAGGG - Intronic
1089719126 11:120395860-120395882 TACATACACATGATATGGTTTGG - Intronic
1090104702 11:123840235-123840257 CACTTACCAATGATGTAGTTTGG + Intergenic
1093975030 12:25412137-25412159 TGCATATCCATGATGTATTTAGG + Intronic
1094385552 12:29889286-29889308 CACATACACATGATTGAGGTTGG - Intergenic
1098527585 12:71503837-71503859 CATATACCCATGATGCTGTGGGG + Intronic
1098894882 12:76047211-76047233 AACACATCCATGAGGTAGTTAGG + Exonic
1099095184 12:78366804-78366826 CACATACCCATGGTCTACTCAGG + Intergenic
1099903026 12:88735895-88735917 TAAATACCCATGATAAAGTTTGG + Intergenic
1102923602 12:116810601-116810623 CACATACCCATGATGTAGTTTGG - Intronic
1109080772 13:57897235-57897257 GAAATATCCATGATGTACTTAGG + Intergenic
1109109347 13:58296122-58296144 CACATTCACAGCATGTAGTTAGG - Intergenic
1110671457 13:78184556-78184578 CACCTTCCCATGAAGTGGTTGGG + Intergenic
1110705488 13:78599214-78599236 CACATCCCCCTGTTGTATTTTGG + Exonic
1115693397 14:35870374-35870396 CAATTAACCATGATGAAGTTTGG + Exonic
1117626116 14:57639912-57639934 CACATGACCATGATGTTGATGGG - Intronic
1118659503 14:67992444-67992466 CACATACCCTTAAGGTAGTTTGG - Intronic
1120259856 14:82169068-82169090 CACTTACCCAAGGTGTAGTTAGG - Intergenic
1126599174 15:50411620-50411642 CACTTATCCATGAAGGAGTTTGG - Intergenic
1127006730 15:54579092-54579114 GGCAGACTCATGATGTAGTTCGG + Intronic
1131379949 15:91955226-91955248 CACATAGCCAAGATGTGGTAGGG + Intronic
1131827838 15:96334240-96334262 TCGATACCCATGATGTTGTTGGG - Exonic
1135718089 16:24790385-24790407 CACTTCCCCATGATGTACTCTGG - Exonic
1139372521 16:66477770-66477792 CTCTTTCCCATGATGGAGTTGGG - Intronic
1142969962 17:3604670-3604692 CACATACACATGATGTGGACGGG + Intergenic
1153926650 18:9840453-9840475 CACAGACCCATGATGCAGAAAGG - Intronic
1154102943 18:11492773-11492795 CACACACACACGTTGTAGTTTGG - Intergenic
1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG + Intergenic
1160188863 18:76698167-76698189 CAAATACACATCTTGTAGTTTGG - Intergenic
931452248 2:62378135-62378157 CATGTACCCCTGATATAGTTTGG + Intergenic
934489284 2:94748250-94748272 TACATATCCCTGATATAGTTTGG - Intergenic
938954490 2:136285346-136285368 CACATACCCCTGAGGTAACTTGG - Intergenic
946059405 2:216928744-216928766 CACATATGCATGATATGGTTTGG - Intergenic
947105850 2:226667346-226667368 CACCTCCACATGATGTAGTCAGG + Intergenic
1169111949 20:3039909-3039931 CACATACCCAGGATGTTTGTGGG + Intergenic
1169921730 20:10741280-10741302 CACATACACATGATGGACTCGGG + Intergenic
1173011482 20:39187096-39187118 CTAATATCCATGATATAGTTTGG + Intergenic
1173978209 20:47203306-47203328 CAAATACCCCTGATATGGTTTGG + Intergenic
1174873761 20:54206684-54206706 CTCATACAAATCATGTAGTTGGG - Intergenic
1178917547 21:36716442-36716464 AACATATCGATGATGTTGTTTGG + Intronic
1184965195 22:47966315-47966337 CACTTTCCCATGCTGTACTTGGG + Intergenic
950092728 3:10307744-10307766 CAAAGCCCCATGATGTGGTTTGG - Intronic
954954792 3:54509634-54509656 AACTTTCCCAAGATGTAGTTTGG + Intronic
958878901 3:99646745-99646767 CACTTACCCTTGATCTTGTTTGG - Intronic
958994314 3:100884838-100884860 CTCATACCCAGTATTTAGTTTGG - Intronic
966838853 3:184071521-184071543 CAAATACACATGATATGGTTTGG - Intergenic
967021618 3:185527806-185527828 CACATGCCCCTGATGGAGTCTGG - Intronic
974454086 4:62103813-62103835 CACATAAACATCATGCAGTTAGG + Intergenic
988507853 5:31839669-31839691 CAAAACCCCATGATGTGGTTTGG + Intronic
994947870 5:106419293-106419315 CACATACACAAAATTTAGTTTGG + Intergenic
997284252 5:132667192-132667214 CACATAGACATAATGTAGCTTGG + Intergenic
999175456 5:149628803-149628825 CACATACCCACGATGTCCTAGGG - Exonic
1004691309 6:17994542-17994564 CACATTCCAATTATGTAGGTCGG - Intergenic
1006643259 6:35499066-35499088 CACATCCCTAGGATGCAGTTGGG + Intronic
1007505823 6:42334674-42334696 CTCTTACCCATGAGGGAGTTGGG - Intronic
1009796946 6:68481298-68481320 TACATTCCCATGATATGGTTTGG - Intergenic
1009992560 6:70862345-70862367 CTCATACCCCACATGTAGTTAGG - Intronic
1010930045 6:81790775-81790797 CACATACCAATTTAGTAGTTTGG - Intergenic
1014439680 6:121460096-121460118 AACATACTAATGAGGTAGTTTGG - Intergenic
1015190336 6:130465201-130465223 CACATATACATGATATAGTTTGG - Intergenic
1016044098 6:139463704-139463726 CATTTACTCATGATGAAGTTAGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018110745 6:160534854-160534876 CACATAACCAGGGTGTAGCTGGG - Intronic
1029177254 7:98673652-98673674 CAAATACCATTGATATAGTTTGG - Intergenic
1030600527 7:111586976-111586998 CTCCTACCCATTATGTGGTTGGG - Intergenic
1032777546 7:135129231-135129253 CAGATACCCATGATGTAGCCAGG - Intronic
1041184503 8:55285234-55285256 CACATACCCATTATGTAAAGTGG + Intronic
1043715971 8:83486924-83486946 CACATAACCCTGAGATAGTTTGG - Intergenic
1046714728 8:117555084-117555106 CAGATAGCCATGAAGTAGTGTGG + Intergenic
1047858980 8:128943858-128943880 CACACACACATGAGGTAATTGGG + Intergenic
1054379642 9:64476083-64476105 TACATATCCCTGATATAGTTTGG + Intergenic
1057910706 9:99017899-99017921 CACATACCCATCGTTCAGTTTGG + Intronic
1189029003 X:37430087-37430109 TATATACACATGATATAGTTTGG - Intronic
1189354210 X:40299057-40299079 CACACACCCCTGATGTGGTCAGG + Intergenic
1189362984 X:40367794-40367816 CACTTGCCCATGCTGTATTTGGG - Intergenic
1189764079 X:44351464-44351486 CCCATACACAACATGTAGTTGGG + Intergenic
1191975360 X:66865244-66865266 CATATAGCCATCAAGTAGTTGGG + Intergenic
1194479560 X:94403738-94403760 CACATATCCATGATGTATTGTGG - Intergenic
1196548969 X:116998636-116998658 GACATCCCCATGATATAGTTTGG + Intergenic
1196594423 X:117527021-117527043 CTCATACACATTATGTAATTTGG + Intergenic
1199808503 X:151326427-151326449 CACCTAACCATGAGGTGGTTAGG + Intergenic