ID: 1102924299

View in Genome Browser
Species Human (GRCh38)
Location 12:116815155-116815177
Sequence CAGAGGCCACTCCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 9, 3: 51, 4: 432}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102924292_1102924299 23 Left 1102924292 12:116815109-116815131 CCTAGTAGTAGTAGATGTAGTCA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG 0: 1
1: 0
2: 9
3: 51
4: 432
1102924291_1102924299 28 Left 1102924291 12:116815104-116815126 CCGGTCCTAGTAGTAGTAGATGT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG 0: 1
1: 0
2: 9
3: 51
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102924299 Original CRISPR CAGAGGCCACTCCCAGGCCT GGG Intronic
900106629 1:984224-984246 CAGAGACCAGACCCGGGCCTGGG + Intergenic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900513651 1:3071426-3071448 GAGAGGTGACTGCCAGGCCTCGG + Intronic
900569420 1:3351068-3351090 CAGCGGCCATTCCCAGGACACGG - Intronic
900600527 1:3500898-3500920 CAGAGGCCTCTCCAGGGGCTAGG + Intronic
901129239 1:6951800-6951822 CAGAGGCCTTTCCCAGGCTGGGG - Intronic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901321480 1:8342991-8343013 CAGTTGCCTCCCCCAGGCCTGGG + Intronic
901667777 1:10836139-10836161 CAGTGGCCCCTCCCAGCCTTGGG + Intergenic
901701365 1:11046431-11046453 CAGAGGCCTCTCCCCTGCCCTGG + Intronic
901923668 1:12552822-12552844 CGGAGGCCACCCCAAGGCCAGGG - Intergenic
902179559 1:14677666-14677688 AGGAGGACACTTCCAGGCCTTGG + Intronic
902376626 1:16032983-16033005 CAGAGGCCACTCAAGGGTCTGGG - Intronic
902408685 1:16200350-16200372 CATAGGCCAGGCCCAGGGCTAGG - Intronic
902556395 1:17249315-17249337 CAGGGCCCACTCCCCAGCCTTGG + Intronic
903173741 1:21568884-21568906 CAGAGGCCACTCCAAGGAGCTGG - Intronic
903471988 1:23593713-23593735 CTGAGGCCACTGCCAGGTGTGGG + Intronic
903788355 1:25875778-25875800 GGGAGTCCACTCCCGGGCCTCGG - Intergenic
903859134 1:26354587-26354609 CTGAGGCCACTTCCAGGGCCAGG + Intergenic
904037248 1:27565411-27565433 CAGAGGCCACTGCCCAGACTGGG + Intronic
904312367 1:29637143-29637165 CAGAGGCCACCCACATTCCTTGG + Intergenic
904409639 1:30317702-30317724 CAGAGGCCCCAGCCAGGCCCAGG + Intergenic
904445894 1:30572684-30572706 CAGAGGCCATACCCAGGGCTGGG + Intergenic
905098892 1:35501023-35501045 AAAAGCCCACTCCCAGTCCTGGG + Intronic
905208267 1:36355488-36355510 CAGAGGAGAGTCCCAGGCCCTGG - Intronic
905309992 1:37042572-37042594 CAGAGGCAGCTCCGAGGCCTGGG + Intergenic
905391196 1:37636360-37636382 CCGAGCCCACTGCCTGGCCTAGG - Intergenic
906211122 1:44012824-44012846 CAGAGGGCACACTCAGGCCGGGG - Intronic
906545047 1:46614657-46614679 CAGAGGTCAAGCCCAGGCTTTGG - Intronic
907461508 1:54608254-54608276 CAGAGGCCACTGCATGGTCTTGG + Intronic
908265774 1:62377858-62377880 CAGAGGCCCCTCCAATGCCACGG + Intergenic
908664354 1:66473683-66473705 TAGAGGACCCTGCCAGGCCTGGG - Intergenic
909479917 1:76119996-76120018 CAGAGGCCAGGCCCAGTGCTGGG - Intronic
911348205 1:96721959-96721981 CCGCGGCCCCTCCCAGGGCTGGG + Intronic
912453722 1:109783845-109783867 CTGTGCCCACTCCCAGGCTTGGG - Intergenic
912693075 1:111819207-111819229 AAGAGGCCTCTCCCCAGCCTGGG + Intronic
913958095 1:143321285-143321307 CAGGGGTCAATGCCAGGCCTAGG + Intergenic
914052410 1:144146660-144146682 CAGGGGTCAATGCCAGGCCTAGG + Intergenic
914126787 1:144819881-144819903 CAGGGGTCAATGCCAGGCCTAGG - Intergenic
915246437 1:154558890-154558912 CAGAGGCAAGCCCCAGGCCCCGG - Intronic
915916061 1:159941738-159941760 CCGAGACCCCTCCCAGGCCTGGG + Intronic
916059094 1:161086712-161086734 CTGAGGCGCCTCCCAAGCCTGGG + Intronic
916380635 1:164207076-164207098 AAGAGGTCACTCTCAGCCCTTGG - Intergenic
919805336 1:201377999-201378021 CAGCTGGCCCTCCCAGGCCTGGG - Intronic
919837050 1:201582330-201582352 CAGCTGCCACTCCCAGGCAGAGG + Intergenic
920296348 1:204959489-204959511 CTGAGGCCACTCCGAGGTCCTGG - Intronic
921075729 1:211698918-211698940 GAGAAAGCACTCCCAGGCCTGGG - Intergenic
921341137 1:214135938-214135960 CAGTGGCCAGGCCCAGGCCCAGG - Intergenic
921372089 1:214434371-214434393 CAGAGGACACTGCCAGCCCTGGG - Intronic
922118236 1:222635313-222635335 CAGAGCCCTCTTCTAGGCCTGGG + Intronic
923538987 1:234874786-234874808 CAGCGGTCACTCCCAGTCATGGG + Intergenic
1063168662 10:3486516-3486538 GAGACGCACCTCCCAGGCCTCGG - Intergenic
1063279346 10:4608033-4608055 CAGAGGCAAATCCCAGCCCAGGG + Intergenic
1064245161 10:13662167-13662189 CAGAGGCCAACCGCAGGGCTGGG + Intronic
1065060943 10:21899856-21899878 CAGAGGCCACCCCTCTGCCTAGG + Intronic
1067576218 10:47410115-47410137 CAGGGGCCACTCCCTGCTCTGGG + Intergenic
1069747095 10:70722439-70722461 CAGAGGACAAGCCCAGGCCTTGG - Intronic
1069901994 10:71711553-71711575 CACAGGACCCTCCCAGGGCTGGG - Intronic
1070611413 10:77935494-77935516 CAGAGGCCCCACTCTGGCCTTGG + Intergenic
1071231855 10:83597353-83597375 CAGAGGGCACTCCCCGGTGTGGG - Intergenic
1071350911 10:84743685-84743707 CAGTGGCCACTCTGAGACCTGGG + Intergenic
1071462272 10:85910479-85910501 CAGAGGCCACTCTAAGGGCAAGG + Intronic
1072259067 10:93650043-93650065 CACTGTCCACTCCCAGCCCTAGG + Intronic
1073061923 10:100738346-100738368 CAGAGGCTGCTCCGAGGCCAAGG - Intronic
1073423439 10:103442082-103442104 CAGCGGCCAGTCCCAGGCCAGGG + Intronic
1073492567 10:103863697-103863719 CAGAGGCCCATCCTAGGCCGAGG + Intergenic
1074162429 10:110845633-110845655 CAGAGCCAACTGCCAGCCCTGGG - Intergenic
1074533133 10:114310598-114310620 CTGAGGCCACATGCAGGCCTTGG - Intronic
1074771526 10:116737958-116737980 CTGCGGGCACCCCCAGGCCTGGG - Intronic
1075154509 10:119963423-119963445 CAGTGGCCACCCACAGCCCTTGG - Intergenic
1076266161 10:129111249-129111271 CAGAGGACAGGCCCAGGCCCAGG + Intergenic
1076420157 10:130325814-130325836 CAGAAGCCACTCACACTCCTTGG - Intergenic
1076484670 10:130808384-130808406 CAGAGTCCCCACCCAGACCTGGG - Intergenic
1076675741 10:132146719-132146741 CAGAGGGCACGACCAGCCCTGGG - Intronic
1076691848 10:132227789-132227811 CCTGGGCCACTGCCAGGCCTGGG + Intronic
1076725012 10:132409186-132409208 CACAGGCCATTCACAGGCCCTGG - Intronic
1076761594 10:132608593-132608615 CAGAGGCCTCTCTGAGGACTGGG + Intronic
1076904469 10:133355268-133355290 CAGTGGCAGCTCCCAGACCTGGG - Exonic
1077028737 11:453695-453717 CAGGAGCCTCTCGCAGGCCTTGG + Intronic
1077053845 11:580435-580457 CAGAGGCCAGGCCCACCCCTCGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077366802 11:2164540-2164562 CTGAGGCCTCTTCCAGGGCTGGG + Intronic
1079158892 11:17974395-17974417 CAGATGCCTCTCCCAGGCCCTGG - Intronic
1079368207 11:19827871-19827893 GCGAGCCCACGCCCAGGCCTAGG + Intronic
1079429380 11:20374490-20374512 TAGAGGCCACCCCCATTCCTTGG + Intronic
1080404515 11:31967014-31967036 AAGAGGCCACTCCCATGCTGTGG + Intronic
1081993094 11:47347964-47347986 CAGAGGCCGCCCCCAGGGCAGGG - Intronic
1083296253 11:61717147-61717169 CAGAGGCTACTTCCTGGTCTGGG - Intronic
1083628504 11:64084198-64084220 CTCAGCCCCCTCCCAGGCCTGGG + Intronic
1083645276 11:64168559-64168581 CAGAGACCACTCACATTCCTTGG + Intergenic
1083699722 11:64467959-64467981 CAGATGCCAATCCCAGTCCTGGG - Intergenic
1083863814 11:65442501-65442523 CAGGGCCAACTTCCAGGCCTGGG + Intergenic
1083913671 11:65726166-65726188 TAGAGGCCACTCTAAGGCCCAGG + Intergenic
1084548434 11:69826093-69826115 GTGAGGCCACCCCCAGCCCTCGG + Intergenic
1085450645 11:76630105-76630127 CACAGGCCACTCCCTGGCTCAGG + Intergenic
1085593768 11:77789934-77789956 CAGACGCCACCTGCAGGCCTTGG + Intronic
1085645533 11:78219907-78219929 CAGAAGGGACTTCCAGGCCTGGG - Intronic
1086255374 11:84869757-84869779 CAGAGCCCAGTACCACGCCTGGG + Intronic
1086898298 11:92338549-92338571 GTGAGGCCACTCGAAGGCCTGGG + Intergenic
1086901339 11:92371433-92371455 CATAAGCCACTACCTGGCCTGGG - Intronic
1089196170 11:116695061-116695083 CAGATGCCACACCGAGGCCCTGG - Intergenic
1089313443 11:117574819-117574841 AAGAGTCCACTGCCTGGCCTGGG + Intronic
1089351201 11:117822601-117822623 CAGCGGCCTCTCCCAGCCCCAGG - Intronic
1090008177 11:123021142-123021164 CAGAGGCCACACTCAGGCCCAGG + Intergenic
1090827188 11:130396038-130396060 CACATGCCAGTCCCAAGCCTGGG - Intergenic
1091100584 11:132869145-132869167 CAGGGGCCACTCCCACCCCATGG + Intronic
1091124008 11:133080566-133080588 GAGAGGACACCCCCAGGTCTGGG + Intronic
1091273103 11:134331849-134331871 CAGAGGCCCCGCCCCGGCCCCGG + Intergenic
1096229077 12:49887565-49887587 CAGGGGCCACTGTCAGTCCTGGG - Intronic
1096243008 12:49969296-49969318 CAGAGGCCACAACCAGCCCCTGG + Intronic
1096531384 12:52244724-52244746 CAGAGGGCACTCTAAGGCCAGGG + Intronic
1096569697 12:52515019-52515041 CAAAGCCCACCCCCAGCCCTCGG + Exonic
1097168996 12:57102110-57102132 CAGAGCCAACCCCCAGGCCTGGG + Intronic
1097809135 12:63999586-63999608 CAGAGGTGACACCCAGGCTTGGG + Intronic
1098774882 12:74600254-74600276 CAGATGCTAGCCCCAGGCCTTGG + Intergenic
1099011264 12:77294107-77294129 CACAGGCCACTTTCAGGCCTTGG + Intergenic
1100548310 12:95623902-95623924 CAGTTGCCAAGCCCAGGCCTAGG + Intergenic
1101467828 12:104966055-104966077 TAGAGGCCACTCACATTCCTTGG + Intergenic
1101626227 12:106444719-106444741 CATAGGCAACTCCCTGGGCTTGG - Intronic
1102218018 12:111175516-111175538 GAGAGGCCACTCAAAGGCATGGG - Intronic
1102770535 12:115472166-115472188 TAGAGGCTGCTCACAGGCCTCGG - Intergenic
1102924299 12:116815155-116815177 CAGAGGCCACTCCCAGGCCTGGG + Intronic
1102968520 12:117147752-117147774 CAGGGGCCACACCCAGTCTTAGG - Intronic
1103273955 12:119696390-119696412 CAGAGACCACTCAGAGGGCTAGG + Intronic
1103726214 12:122998557-122998579 CAGTGGCCCCTCTCAGGCCCTGG - Intronic
1103876680 12:124132947-124132969 CACAGGTGAATCCCAGGCCTTGG - Intronic
1104095475 12:125553291-125553313 TAGACGCCAGTCCCAGGGCTGGG + Intronic
1104438497 12:128775979-128776001 CGGAGGCCACGCCCAGAGCTTGG - Intergenic
1104764504 12:131317854-131317876 GAGAGGCCCCTCCCCAGCCTGGG + Intergenic
1105071113 12:133235252-133235274 CAGAGGAGGCTCCCAGGCCTGGG + Exonic
1105900369 13:24747320-24747342 CAGGGGCCTCTCCCATGCCCTGG + Intergenic
1106410709 13:29509346-29509368 CATGGGGCACTTCCAGGCCTGGG + Intergenic
1106724869 13:32473680-32473702 CAGAGGCCACTGACATTCCTTGG + Intronic
1107803295 13:44130866-44130888 CTGAGGCCACTGTCAGGTCTGGG - Intergenic
1110899457 13:80802377-80802399 AAGAGGCCACTCACATGCCTTGG - Intergenic
1112236014 13:97637421-97637443 AAGATGCCACTCTCAGGCCTAGG + Intergenic
1112372328 13:98804647-98804669 CAGCAGCCACACCCAGTCCTGGG - Intronic
1113061757 13:106330016-106330038 CAGAGGGCACTCTCAAGCCAGGG + Intergenic
1114454936 14:22848210-22848232 AAGAAGCCTCTTCCAGGCCTGGG + Intronic
1114528180 14:23379193-23379215 CAGAAGCCACAGCCAGGACTTGG + Intronic
1119278199 14:73379862-73379884 CAGAGGCCATTCCAAGTACTTGG + Intronic
1120416012 14:84219065-84219087 TAGAGGCCACTCACATTCCTTGG - Intergenic
1121278190 14:92681739-92681761 CAGAGCCGACTTCCTGGCCTGGG + Intronic
1121423514 14:93832292-93832314 CAGAGCCCAACCCAAGGCCTAGG - Intergenic
1122087679 14:99318802-99318824 CACAGGCCACTCCCAGCCAAGGG + Intergenic
1122113395 14:99516316-99516338 CAGAGGCCACCGGCAGACCTCGG + Intronic
1122367350 14:101201979-101202001 TAGAGGCCACTCACATCCCTCGG + Intergenic
1122958733 14:105084847-105084869 CAGTGGCCGGTCCCAGGGCTGGG + Intergenic
1122968538 14:105143237-105143259 CGCAGGGCCCTCCCAGGCCTGGG - Intronic
1122978492 14:105180926-105180948 CCGCGGCCCCTCCCCGGCCTGGG + Intronic
1124694080 15:31848829-31848851 CACTGGGCACTCTCAGGCCTTGG + Intronic
1125725650 15:41866934-41866956 CAGAGGGCACCCCCAGCCCAGGG - Intronic
1125891911 15:43273477-43273499 CAGGAGCCACTGCCTGGCCTGGG + Intergenic
1126344556 15:47679230-47679252 CAGAGCTCAGTCCCAGGTCTGGG - Intronic
1126414288 15:48401753-48401775 CACAGGCCACACCCAGGACCTGG + Intergenic
1127396378 15:58546885-58546907 CAGAAGGCTCTCTCAGGCCTGGG - Intronic
1128522623 15:68385874-68385896 CTCAGACCCCTCCCAGGCCTGGG + Intronic
1129231786 15:74201156-74201178 CAGAGGCTCCACCCAGGCCTCGG - Intronic
1129244481 15:74271259-74271281 CAGAGACCCCTCACAGCCCTGGG + Intronic
1129412603 15:75358390-75358412 GAGGGGCCAGCCCCAGGCCTTGG - Intronic
1130557817 15:84935272-84935294 CAGAGCCCAGGCCCAGCCCTCGG + Intronic
1130684679 15:86026266-86026288 CAGAGGCCCCTCCAAGACCATGG - Intergenic
1130899079 15:88193381-88193403 CAGAGCTCCCTCCCAGGCCCAGG + Intronic
1130964460 15:88686530-88686552 CAGTGGCCACTGCCAGGGCATGG + Intergenic
1132802163 16:1759756-1759778 CAGAGCAGGCTCCCAGGCCTTGG - Intronic
1132834657 16:1946747-1946769 CAGAGGCCACTTCCTGCCCCTGG - Intronic
1132889005 16:2195293-2195315 CAGAAGCCAGTCCCAGTTCTCGG + Intronic
1132931485 16:2461136-2461158 CTGAGGCCCGCCCCAGGCCTGGG - Exonic
1133018375 16:2955233-2955255 AAGCGGCCCCTCCCCGGCCTGGG - Intergenic
1133804740 16:9116211-9116233 CAGAAATCACTTCCAGGCCTAGG - Intronic
1133927234 16:10203079-10203101 TAGAGGCCACTCTCAGGTCCTGG - Intergenic
1134024074 16:10941555-10941577 GAGAGGGCACTTACAGGCCTCGG + Exonic
1134693656 16:16207271-16207293 CAGGGGCCAATCCCATGCCCAGG - Intronic
1134978190 16:18587372-18587394 CAGGGGCCAATCCCATGCCCAGG + Intergenic
1136110118 16:28059396-28059418 GAGAGACCAGTCCCAGGGCTGGG - Intronic
1136395882 16:29992153-29992175 AAGGGGCTGCTCCCAGGCCTGGG + Intronic
1136532832 16:30881503-30881525 CAGAGGCCACTGTCAAGACTTGG - Intronic
1137003479 16:35251448-35251470 CAGAGGCTCTTCCCAGGACTGGG + Intergenic
1138487132 16:57352911-57352933 CAGGGGGCACTCCAAGGCCGAGG - Intergenic
1138647563 16:58436104-58436126 CAGAGCCCAGGCCCAGGCCGGGG - Intergenic
1138899872 16:61256089-61256111 CAGAAGCCACTCCCACACCAGGG + Intergenic
1139312654 16:66040385-66040407 CAGAGGCTACTTCCAGGGCCAGG - Intergenic
1139955393 16:70690703-70690725 CTGAGGACAGTCCCAGCCCTGGG - Intronic
1141066136 16:80915572-80915594 TAGAGGCCACTGACAGTCCTTGG + Intergenic
1141111657 16:81275357-81275379 CTGAGACCACACCCGGGCCTGGG - Intronic
1141182021 16:81760266-81760288 CAGTGCCCACTGCCAGGACTGGG + Intronic
1141412556 16:83845399-83845421 CACCCGCCACTCTCAGGCCTGGG + Intergenic
1141597546 16:85106590-85106612 CAGAGGCCACGCACATCCCTTGG - Intronic
1141629279 16:85277869-85277891 CACAGGCCAGTCCCAGGCAGAGG - Intergenic
1141841301 16:86575957-86575979 CAGAGGCCCCTCCTAGGCTCAGG + Intergenic
1142149984 16:88508478-88508500 CAGAGTCCAACCACAGGCCTTGG + Intronic
1142190238 16:88714078-88714100 CAGAGGCCAGCCCCAGGCTGGGG - Intronic
1142254288 16:89006546-89006568 CATAGCTCACTCCCAGCCCTGGG - Intergenic
1203124252 16_KI270728v1_random:1561203-1561225 CAGGGGCCAATGCCAGGCCAAGG - Intergenic
1143032632 17:3976414-3976436 CAGGGGGTGCTCCCAGGCCTGGG + Intergenic
1143328288 17:6115976-6115998 CAGAGCCCAATCCCAAGCTTGGG - Intronic
1144699121 17:17325295-17325317 CAGAGGGCAGTCCCGGGCCGAGG - Intronic
1144745109 17:17608937-17608959 TAGAGGGCATTCCCGGGCCTAGG + Intergenic
1144825739 17:18104757-18104779 CAGAGCCCACCCCCAGCCCAGGG - Intronic
1144914479 17:18712017-18712039 CAGACTCCATTCCCAGGCCCAGG - Intronic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1146884848 17:36464086-36464108 CAGCCGCCACTCCCCAGCCTGGG - Intergenic
1147140812 17:38459690-38459712 CAAAGGCCCCTCCCAGCCCTGGG - Intronic
1147158098 17:38555078-38555100 CAGGTGCCACACTCAGGCCTTGG + Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148589452 17:48804953-48804975 CAGAGCCTCCTCCCAGGCCAGGG - Exonic
1148899618 17:50866196-50866218 CAGAGGCCTCGGGCAGGCCTTGG + Exonic
1151380136 17:73720091-73720113 CAGAAGGCACAGCCAGGCCTGGG - Intergenic
1151541957 17:74769195-74769217 CTGAGGCCACTGCCATGCCCTGG - Exonic
1151828406 17:76536281-76536303 CTGTGGCCTCTCCCAAGCCTGGG - Intronic
1152072464 17:78140698-78140720 CAGAGGCCACGCCCCGCCCGAGG - Intronic
1152590795 17:81211006-81211028 CAGAGGCCACTGTGAGGTCTGGG + Intronic
1152643698 17:81459405-81459427 CCGCAGCCACTCCCAGGCCCAGG + Intronic
1152814785 17:82401088-82401110 CTGAAGGCAGTCCCAGGCCTTGG + Intronic
1153793047 18:8597044-8597066 CAGAAGCCCCTCCAAGGCCTGGG + Intergenic
1153922677 18:9805389-9805411 CAGAGACCACTCGCATTCCTTGG + Intronic
1155221409 18:23689503-23689525 GAGAGGCCACCCCCACGCCGCGG + Exonic
1155243335 18:23884263-23884285 CAGAGACCACTCGCCTGCCTCGG - Intronic
1155850060 18:30763142-30763164 CACAGGCGACTCCCAGGTCAAGG + Intergenic
1156507553 18:37607931-37607953 CAAAGGCCACACCCATGGCTAGG + Intergenic
1157440991 18:47711569-47711591 CAGAGAACACACCGAGGCCTTGG - Intergenic
1157804002 18:50644550-50644572 CAGAGGCCATTTCCAGGGCTTGG - Intronic
1160538426 18:79607575-79607597 CAGATGCCAGCCCCAGTCCTTGG + Intergenic
1160934135 19:1585254-1585276 CAGACCCCAAACCCAGGCCTCGG + Intronic
1161107073 19:2449289-2449311 AGGAGGCCACGCCCAAGCCTGGG + Intronic
1161161073 19:2762159-2762181 CAGGGGCAGCCCCCAGGCCTGGG + Intronic
1161234018 19:3189152-3189174 CAGAGTCCACTCCCAGGAGAGGG - Intronic
1161397677 19:4053029-4053051 CAGAAGCCGCTCCACGGCCTGGG + Intronic
1161731531 19:5963958-5963980 CAGGGGACTCTCCCTGGCCTGGG - Intronic
1162020802 19:7867568-7867590 AAGTGGCCTCTCCCAGGTCTAGG - Intergenic
1162022181 19:7872972-7872994 AAGGGGCCACGCTCAGGCCTAGG + Intronic
1162397940 19:10428740-10428762 CAGAGGCCACACGCAAGCCCAGG + Intronic
1162634706 19:11958325-11958347 CAGATGCCACTCAAAGCCCTAGG - Intronic
1163466335 19:17470368-17470390 CAGACTCCGCCCCCAGGCCTGGG - Intronic
1163500359 19:17672601-17672623 CCTAGGACACTCCCAGGCCTAGG - Intronic
1163597294 19:18227506-18227528 CAGAGGCCCCCCCCAGTCCTGGG - Intronic
1164874720 19:31675797-31675819 CAGAGGCCATTCCCAGGGTTTGG + Intergenic
1165114141 19:33518882-33518904 CAGAAGCCTTTCCCAGCCCTCGG - Intronic
1166956510 19:46468932-46468954 TGGAGGCCAATCCCAGGCCTTGG + Intronic
1167113167 19:47473721-47473743 CAGAAGCCAGGCCCAGGCGTGGG - Intergenic
1167129290 19:47573537-47573559 CAGAGGCCCCTCCGGGGACTGGG - Intergenic
1167156673 19:47743064-47743086 CAGAGGCCCCTCCCAGCCATGGG - Exonic
1168311660 19:55463834-55463856 CACAGGCCACTCCCAGGAAGGGG + Intergenic
1202691808 1_KI270712v1_random:99084-99106 CAGGGGTCAATGCCAGGCCTAGG + Intergenic
925387424 2:3471961-3471983 CTGTGGCCAGTCCTAGGCCTCGG + Intronic
925462476 2:4075355-4075377 CAGGGCCCTCTCCCTGGCCTGGG + Intergenic
925542329 2:4979321-4979343 CAGTGGCCTCTGCCAGGCCTGGG - Intergenic
926142371 2:10375369-10375391 CAGTGGCCCCTCCCAGGACTCGG + Intronic
929534207 2:42770365-42770387 GAGAGCCCACTGCCAGGCCGGGG - Intronic
929601999 2:43210380-43210402 CAGAGGCCTCTCCCTGGCATAGG - Intergenic
929898090 2:45978774-45978796 CAGAGGGCAGTCCCAGTGCTTGG - Intronic
932448404 2:71794589-71794611 CAGACTCGAGTCCCAGGCCTGGG - Intergenic
932573815 2:72951873-72951895 CTGAGGCCTCTGCCAGGCCTGGG + Intronic
932779104 2:74549058-74549080 GCGAGGCCACTCCCAGGCGCGGG - Intronic
933560109 2:83877448-83877470 CAGTGGCCGCTCCGAGGCCGGGG + Intergenic
933899073 2:86836303-86836325 CAGAGGACCCCCACAGGCCTCGG + Intronic
934925531 2:98379588-98379610 CAAAGGAACCTCCCAGGCCTGGG + Intronic
936069566 2:109356593-109356615 CAAAGGCCCATCCCAGGGCTTGG + Intronic
937207542 2:120246226-120246248 GAGGGGCCAGTCCCAGTCCTGGG + Intronic
937911496 2:127077847-127077869 CAGAGGCCTCTCCCAGGCAGTGG + Intronic
938116481 2:128606104-128606126 CAGAGGCCACCCTCATTCCTAGG + Intergenic
938772266 2:134510786-134510808 GAGAGGCCTCTTCCCGGCCTAGG + Intronic
942333874 2:174859383-174859405 CAGAAACCTCTTCCAGGCCTAGG + Intronic
943551135 2:189340472-189340494 AAGAGGCCACACTCTGGCCTGGG + Intergenic
946418962 2:219554270-219554292 CAGGGGCCACACCCAGGCAGAGG + Intronic
947217344 2:227761247-227761269 CATAGGCTAGTCCCAGCCCTGGG - Intergenic
947531307 2:230910308-230910330 CCGAGACCACACCCAGGACTGGG - Exonic
947638491 2:231692991-231693013 GCGCGGCCACACCCAGGCCTTGG - Intergenic
947718663 2:232354340-232354362 CCCAGGCCACACTCAGGCCTGGG + Intergenic
947797134 2:232901693-232901715 CACAGGTCACCCCCAGTCCTGGG + Intronic
948045412 2:234940051-234940073 CAGAGACAATTGCCAGGCCTGGG + Intergenic
948223504 2:236291383-236291405 CAGAGGACACTCACCTGCCTTGG + Intergenic
948537792 2:238658915-238658937 CCAAGGCTTCTCCCAGGCCTGGG + Intergenic
948940037 2:241190940-241190962 CAGAGGGCACCACCAGCCCTGGG - Intronic
949037902 2:241826683-241826705 CAGAGCCCACTCCCAACCCAGGG - Intergenic
1169088095 20:2839840-2839862 CATGGTCCACTTCCAGGCCTCGG - Exonic
1170695942 20:18658904-18658926 CAGATGCCACACCCAAGCCTGGG - Intronic
1170706024 20:18745521-18745543 GAGAGGCCCCTCAGAGGCCTGGG + Intronic
1170850030 20:19996442-19996464 CCTTGGCCCCTCCCAGGCCTGGG + Intronic
1170947046 20:20900735-20900757 CAAATGGCCCTCCCAGGCCTGGG + Intergenic
1171094312 20:22316755-22316777 CAGAGGTCTCTCCCAGGCCTGGG - Intergenic
1171220256 20:23390569-23390591 TGGGGGCCACTCCCAGGCTTGGG + Intronic
1171335259 20:24379777-24379799 CAGCAGCCACTCCCAGGGCATGG - Intergenic
1171415814 20:24979748-24979770 CAGAGGCTGCTGCCAGGACTTGG - Intronic
1172331727 20:34080172-34080194 CCCAGGACACTCCCAGGCTTGGG + Exonic
1173616507 20:44406663-44406685 AAGAGGGCTCTCCAAGGCCTTGG - Intronic
1173930592 20:46814728-46814750 CAGATGCCTCTGCCAAGCCTGGG + Intergenic
1174911945 20:54617183-54617205 CAGAGGCCACTCTCAGCTCCTGG + Intronic
1175199641 20:57268219-57268241 TAGAGGCCCCTCCCTGGCATGGG - Intergenic
1175357216 20:58377954-58377976 CAGAGGTCACACACAGTCCTTGG - Intergenic
1175532589 20:59684403-59684425 CCAAGGCCACCTCCAGGCCTGGG - Intronic
1175594824 20:60222653-60222675 CACAGGCCACTCCCACTCCTTGG - Intergenic
1175597773 20:60249104-60249126 CACAGGCCATCCCCTGGCCTTGG + Intergenic
1175741711 20:61424607-61424629 TAGAGGCCACTCCTAGGCCAGGG + Intronic
1175890140 20:62312365-62312387 CAGATGCCACCCCCAGCCCGGGG + Intronic
1175911790 20:62408507-62408529 CCAAGGCCTCTGCCAGGCCTAGG + Intergenic
1175960155 20:62631760-62631782 CAGGACCCACTCCCAGGCCCAGG - Intergenic
1176205948 20:63888206-63888228 CAGATACCCCTCCCAGGCCCGGG - Intronic
1176241548 20:64077932-64077954 CGGAGGCCCCTCCCTGCCCTGGG - Intronic
1178427161 21:32487949-32487971 CAGATGCCAATCGCAAGCCTGGG - Intronic
1178536141 21:33411736-33411758 TAGAGGCCACTCCCATTCTTTGG - Intronic
1178853654 21:36233317-36233339 CAGACCCCACTCCCAGGCAGGGG - Intronic
1179143061 21:38744346-38744368 CAGAGGACGATCCCAGCCCTCGG + Intergenic
1179547212 21:42120839-42120861 CAGATCCCCCTCCCAGCCCTGGG + Intronic
1179779017 21:43687717-43687739 CAGAGGCCACGTCCAGCACTGGG + Exonic
1179982388 21:44903173-44903195 CAGGGGCCACACCCAGTCCCTGG - Intronic
1180000397 21:44992971-44992993 GGGAGGCCACTTCCAGGCCTAGG + Intergenic
1180092448 21:45540005-45540027 CAGGGGCCACTGCCAGGCCGAGG + Intronic
1180720300 22:17902961-17902983 CACAGGACACTCCCACGTCTCGG + Intronic
1180727870 22:17959967-17959989 CAGAGTGCACTCCTAGGCATTGG - Intronic
1180796090 22:18606484-18606506 CAGAGGCCACTACCTGGGCAAGG + Exonic
1181000963 22:19987487-19987509 CCGAGGCCAAACCGAGGCCTGGG - Intronic
1181057932 22:20268557-20268579 CAGAGGCCATTCCTAGGCCTCGG - Intronic
1181225632 22:21388787-21388809 CAGAGGCCACTACCTGGGCAAGG - Exonic
1181253002 22:21546026-21546048 CAGAGGCCACTACCTGGGCAAGG + Exonic
1181378604 22:22480964-22480986 CAGACACCACTCCCAAGTCTGGG - Intergenic
1182432170 22:30305806-30305828 CCAAGGCTACTCTCAGGCCTGGG - Intronic
1182516358 22:30861301-30861323 CACAGGCCCCACCCTGGCCTTGG + Intronic
1182620695 22:31616911-31616933 CTCAGGCCACTCCCGGACCTGGG + Intronic
1183261574 22:36798922-36798944 TTGAGTCCTCTCCCAGGCCTGGG + Intergenic
1183432652 22:37774979-37775001 CAGAGGTCATGCCCAGCCCTGGG + Exonic
1183893580 22:40950694-40950716 CAGAGGCCACCCCCCAGGCTTGG + Intergenic
1184045694 22:41971138-41971160 CAGGGGCCACACTCAGGCCCAGG + Intergenic
1184093764 22:42305709-42305731 CAGGGGCCACTGTCAGGCCAGGG - Intronic
1184737442 22:46407740-46407762 CACAGGCCACTCCCGTGCCAGGG + Intronic
1184820342 22:46905312-46905334 CAGAGGCCTCCTCCAGGCCCAGG - Intronic
1185126933 22:49016628-49016650 CAGAGTGCACCTCCAGGCCTTGG - Intergenic
1185214853 22:49592926-49592948 CAGAGGGCCCTCCCTGGCGTGGG + Intronic
1185215001 22:49593719-49593741 AAGATGCCCCTCGCAGGCCTGGG - Intronic
949510202 3:4760699-4760721 CAGAGGCCACCCACATCCCTTGG + Intronic
950140407 3:10611314-10611336 CAGGGGCACCTCCCTGGCCTGGG + Intronic
950163418 3:10776474-10776496 CAGAGGCCACTGACAGCCCCTGG + Intergenic
950516123 3:13466653-13466675 AGGAGGCCACTCCCATTCCTAGG + Intergenic
950831608 3:15880018-15880040 CAGAGACCACTCCTTGGTCTAGG - Intergenic
952925613 3:38317176-38317198 CAGAGGACACTCTAGGGCCTCGG - Intronic
953537395 3:43786731-43786753 CAGAGGGCTCACCCAGGCCAAGG - Intergenic
953610888 3:44446325-44446347 CAGAGGCCACTCCTAGGGGCCGG + Exonic
953743334 3:45555338-45555360 CAGAAGCCCCACCCTGGCCTGGG + Intergenic
954389096 3:50259700-50259722 CAACGGACACTCTCAGGCCTTGG - Intergenic
954814002 3:53266164-53266186 CAGATGCCAATCACAGGTCTTGG + Intergenic
954945960 3:54424622-54424644 CAGAGCCCACCCCCAGGTCCTGG - Intronic
955230889 3:57097898-57097920 CAGAAGTCACTCTCAGGCCCTGG + Exonic
955972971 3:64454218-64454240 CAGAGGCCCCTCACATTCCTTGG + Intergenic
957140220 3:76345251-76345273 CAGAGGCCTTTCCCATGACTTGG - Intronic
958169345 3:89918386-89918408 AAGAGGCCACTCCCTGGCCTGGG + Intergenic
960713662 3:120555787-120555809 CAGAGACCCCACCCAGGCCTTGG + Intergenic
961042632 3:123688167-123688189 CAGAGGCCATTCACTGCCCTGGG - Intronic
962071199 3:132035121-132035143 CTCAGGCCCCGCCCAGGCCTTGG + Exonic
966489994 3:180516924-180516946 CAGAGGACACACACAGACCTGGG + Intergenic
967159035 3:186718481-186718503 CAGATACCACTCTCTGGCCTGGG + Intronic
967891230 3:194365863-194365885 CAGAGGCCCCTCCCAGTCCCTGG - Intronic
967980384 3:195061878-195061900 CAGCGGGCACTCTCAGCCCTCGG + Intergenic
968045828 3:195623552-195623574 CTGAGGGCACACCCAGGCCCCGG - Intergenic
968308828 3:197666535-197666557 CTGAGGGCACACCCAGGCCCCGG + Intergenic
968454037 4:688333-688355 CAGGAGTCACTCTCAGGCCTGGG - Intronic
968491455 4:892612-892634 CAGGGTCCACTCCCAGGCACCGG - Intronic
968540876 4:1167750-1167772 CAGAGGCCACGCCCACCCTTCGG + Intronic
968654349 4:1772154-1772176 CAGGGACCCCTCCCAGGGCTGGG - Intergenic
968658057 4:1787115-1787137 CCGACCCCACTCCCAGGCCAAGG + Intergenic
968779643 4:2570773-2570795 CAGGCCCCACTCCCCGGCCTGGG + Intronic
969318717 4:6397327-6397349 CTGAGGCCTCCCCCTGGCCTGGG - Intronic
969341140 4:6542255-6542277 CAGAAGCCAGTCCTATGCCTAGG + Intronic
969620093 4:8274475-8274497 CAGAGGCCACGCACTGGCCCAGG - Intronic
969846858 4:9926119-9926141 CAGGGGGCACTCCCAGGTGTGGG - Intronic
972400989 4:38703521-38703543 CAGAGACCGCTCCCATGCCTTGG - Intergenic
974216132 4:58849937-58849959 CAGAGGTCTCTGCCAGGCTTTGG + Intergenic
975597270 4:76060803-76060825 CAGAGGCCACCCACATTCCTTGG - Intronic
977370347 4:96126547-96126569 CAGAGCGGACTCCGAGGCCTAGG + Intergenic
979887450 4:126046786-126046808 CAGAGGGCATATCCAGGCCTGGG - Intergenic
980035717 4:127880946-127880968 CAGAGGCACCGCCCAGGCCTCGG + Exonic
985482091 5:119686-119708 CAGAAGCCACTGTCATGCCTGGG + Intergenic
985718437 5:1475883-1475905 CACAGGCCCCGCCCAGGCCCAGG + Intronic
985747467 5:1655290-1655312 CTGAGGGCACACCCAGGCCCTGG + Intergenic
985969220 5:3362103-3362125 CAGAGGCCGCTCCTGGCCCTGGG + Intergenic
986009346 5:3698341-3698363 CCGACCCCACTCCCAGGGCTGGG + Intergenic
986430750 5:7678975-7678997 CAGAGGCCATTGCCTGGCATAGG - Intronic
986523783 5:8650250-8650272 CAGGGGCCATTCCCAGGCAGAGG - Intergenic
986860205 5:11918650-11918672 CACTGGCCGCGCCCAGGCCTTGG + Intergenic
987542368 5:19271763-19271785 CAGAGGCCACTCCCATTCCTTGG - Intergenic
988935089 5:36073889-36073911 CTGAGTCTGCTCCCAGGCCTTGG + Intergenic
990473846 5:56142721-56142743 CAGAGGCCAGCCCCAGGGCATGG + Intronic
992754620 5:79892607-79892629 CAGAGGCCACTCATATTCCTTGG - Intergenic
994017938 5:94990119-94990141 CAGATGCCAATCCCAAGTCTAGG - Intronic
996876464 5:128245913-128245935 TAGAGGCCACTCACATTCCTCGG + Intergenic
997374456 5:133387209-133387231 CAGTGGCCACTCCCATGATTAGG - Intronic
997568456 5:134906982-134907004 CAGGGACCACACCCAGGACTGGG - Intronic
998476381 5:142425646-142425668 GATAGGCCACTCCCTGGCTTTGG - Intergenic
999134931 5:149312230-149312252 GAGTGGCCACTGCCTGGCCTGGG - Intronic
999205235 5:149842865-149842887 CAGCAGCAAGTCCCAGGCCTTGG + Intronic
999514738 5:152289501-152289523 GAAAGGCCACCCCCAGGCCAGGG + Intergenic
1000908919 5:166997109-166997131 CAGAAGCCACACCCAGGGCTGGG + Intergenic
1001597031 5:172905021-172905043 AAGAAGCCTCTCCCAGGCGTGGG - Intronic
1001961887 5:175884501-175884523 CACAGGCACTTCCCAGGCCTTGG + Intergenic
1001993539 5:176135627-176135649 CTGAGCCCACACCCAGGCCCTGG - Intergenic
1002538766 5:179892696-179892718 CAGAGGCCTCTCACAGCCATGGG - Intronic
1002811708 6:637449-637471 CAGAGGCAAATCTCAGCCCTGGG + Intronic
1002871372 6:1169921-1169943 CCCAGGCCCCTCCCAGGCCAGGG - Intergenic
1003427840 6:6009074-6009096 CTTAAGCCACTCCCAAGCCTGGG - Intergenic
1003500168 6:6696607-6696629 GAGAGGCCAATCCTAGGGCTTGG + Intergenic
1003884483 6:10509143-10509165 CAGCTGCTACTCCCAGGTCTGGG + Intronic
1004731762 6:18366262-18366284 CAGAGACCTCCCCCTGGCCTAGG + Intergenic
1005502509 6:26442149-26442171 CAGAGGCCATTCCCAGACTCAGG + Intronic
1006365288 6:33611531-33611553 CAGAGGCCACTCCCTCTCCTTGG + Intergenic
1006390469 6:33755246-33755268 AGGAGGCCACTTGCAGGCCTGGG + Intergenic
1006582888 6:35086855-35086877 CAGGGGCCACAGCCTGGCCTGGG + Intronic
1006913788 6:37581696-37581718 CACAGGCCTATCCCAGGGCTGGG + Intergenic
1006922994 6:37638498-37638520 CAGAGGACCCTCCCCGGCTTCGG - Intronic
1007609744 6:43141836-43141858 CAGAGGGCCCTCCCAGCCCCAGG - Intronic
1007754554 6:44090461-44090483 CAGAGGGGACTGCCAGGCCGTGG + Intergenic
1007941296 6:45783886-45783908 CCTATGCCACTCCCAGGCCTGGG - Intergenic
1008276621 6:49550707-49550729 CAGAGGCCACACCCAGGGCTTGG + Exonic
1009312336 6:62170406-62170428 CACAGTCTGCTCCCAGGCCTTGG - Intronic
1010042502 6:71402292-71402314 GAGAGGCCTCTGCCAGGCCCTGG - Intergenic
1011204020 6:84872238-84872260 CAGAGGCCTCTCCCAGGCAGTGG + Intergenic
1011744063 6:90392087-90392109 CAGTGGCCACTCCCAGGGAGGGG - Intergenic
1013248713 6:108313254-108313276 CAGATGCCACTTCCTGGCTTTGG + Intronic
1013602233 6:111715628-111715650 CAGAGGCCACCCTCAGTTCTTGG - Intronic
1013923038 6:115432861-115432883 CACAGACCACTACCAGTCCTTGG - Intergenic
1015044309 6:128760190-128760212 CAGAGGTCTCTCTCAGTCCTGGG - Intergenic
1015799563 6:137046524-137046546 CACAGGCCACTCACAGGTTTGGG - Intergenic
1016706611 6:147116165-147116187 CTGAGGCCAATGACAGGCCTTGG - Intergenic
1017893200 6:158656226-158656248 GAGACGCCACCGCCAGGCCTGGG - Intronic
1018064738 6:160117091-160117113 CAGAGGTAACTCCCTGGCCCAGG + Intergenic
1018826138 6:167409073-167409095 CAGAGACCAGAGCCAGGCCTTGG - Intergenic
1018990038 6:168667590-168667612 CAGCTGCCACCCTCAGGCCTGGG + Exonic
1019303035 7:318556-318578 CAGTGGCCATTCACAGGCTTGGG + Intergenic
1019666475 7:2254488-2254510 CACAGGCCACTCCCAGACCAGGG + Exonic
1022465016 7:30647843-30647865 CAGAGGCCAGTCCCAGACAGAGG - Intergenic
1023819633 7:43973350-43973372 CCCAGGCCACCCCCAGGCCCTGG + Intergenic
1023968423 7:44975420-44975442 CCGAGACCCATCCCAGGCCTGGG - Intronic
1023990692 7:45126519-45126541 CAGAGGCCAGGCCCAGTGCTGGG + Intergenic
1024263276 7:47587630-47587652 CAGCGGTCACTCTCAGGCCAGGG - Intergenic
1024339293 7:48240900-48240922 CAGAAGACACTCACAGGCATGGG + Exonic
1025806458 7:64838234-64838256 CAGCGGCCGCTCCGAGGCCGGGG + Intergenic
1026845853 7:73698860-73698882 CAGAGGCCACTCTCAAGGCCTGG - Intronic
1026854084 7:73741855-73741877 CAAGGACCCCTCCCAGGCCTGGG - Intergenic
1026960448 7:74404335-74404357 CCGAAGCCACTTCCAGGCCAAGG + Exonic
1029596871 7:101542669-101542691 CAGTGGCCAGTCCCAGGGCCGGG + Intronic
1029744684 7:102510319-102510341 CCCAGGCCACTCCCAGGCCCTGG + Intronic
1029762675 7:102609481-102609503 CCCAGGCCACTCCCAGGCCCTGG + Intronic
1030628094 7:111865828-111865850 CAGAGGCCACTTGCAGTCCTTGG - Intronic
1030710340 7:112741650-112741672 CAGATACCACTCCTAGGGCTGGG + Intergenic
1031986249 7:128166526-128166548 CAAAGGCCGCTCCCGGGCATTGG - Intergenic
1032513955 7:132493290-132493312 AGGAGGCCAGCCCCAGGCCTAGG - Intronic
1032740402 7:134732891-134732913 CAGAGCGCACATCCAGGCCTGGG - Intergenic
1034545296 7:151785221-151785243 CAGGGGCCACAGCCAGGCCCTGG - Intronic
1035118818 7:156548031-156548053 CAGAGACCCCACCCAGGCTTCGG + Intergenic
1035209017 7:157314123-157314145 CAGAGCCCGCTCCCAGGGCTGGG - Intergenic
1035255767 7:157626124-157626146 CAGAGGCCAGGCTCAGGCTTTGG - Intronic
1035734422 8:1877674-1877696 CTGAGGCACCTCCCAGGTCTCGG + Intronic
1035761162 8:2070001-2070023 CAGAGACCCGCCCCAGGCCTAGG + Intronic
1035775487 8:2184276-2184298 CAGCGATCATTCCCAGGCCTGGG - Intergenic
1036223883 8:6942551-6942573 CAGATGCACCTCCCAGGGCTTGG - Intergenic
1036585477 8:10119435-10119457 TACAAGCCACTCCCAAGCCTGGG - Intronic
1039940400 8:42085286-42085308 CAGAGCCCACTCCCTATCCTGGG - Intergenic
1043373107 8:79615357-79615379 CAGTGGCCACGCCCAGGCCTAGG - Intronic
1048178952 8:132177952-132177974 CAGAGCCCATTCCCACCCCTGGG + Intronic
1048273612 8:133048799-133048821 CAGATGCCACTTCCATGCTTAGG - Intronic
1048302908 8:133264806-133264828 CAGAAGCCACTCCAAGGACCAGG + Intronic
1048586736 8:135781118-135781140 CAGAGTCCAGAGCCAGGCCTAGG + Intergenic
1048715249 8:137261440-137261462 CAGTGAACACTCCCAGGCTTGGG - Intergenic
1049654512 8:143791819-143791841 CAGACCCCACCCCCATGCCTCGG + Intronic
1050658408 9:7855010-7855032 CAGAGTCCACTTTCAAGCCTTGG + Intronic
1056699705 9:88892104-88892126 CAGAGCCCAGTCCGAAGCCTTGG + Intergenic
1057025630 9:91732426-91732448 AACAGGCCACACCCAGGCCCCGG + Intronic
1057449349 9:95143004-95143026 CAGATGCCAATCACAGGTCTAGG + Intronic
1057794681 9:98146709-98146731 CCGAGGCCACACCCAGGTCTGGG + Intronic
1059948482 9:119437693-119437715 TAGAGGCCACTTCCATTCCTTGG + Intergenic
1060488991 9:124068174-124068196 GAGCGACCACTCCCGGGCCTGGG + Intergenic
1060553306 9:124495771-124495793 CAGAGCCTGCTCCCAGGGCTGGG - Intronic
1060855962 9:126915110-126915132 CCGAGGCCCCTCCCCGGCTTCGG - Intronic
1061007896 9:127938490-127938512 CACAGGCCCCTCCCCGGTCTTGG + Intergenic
1061179125 9:129013705-129013727 CAGAGGGAACTCCCAGGCCCAGG - Intronic
1061610266 9:131740932-131740954 ATGAGGCCACTCCCAGGCCCTGG - Intergenic
1062526342 9:136979424-136979446 CAGAGGCAAAGGCCAGGCCTGGG + Intronic
1062617804 9:137405885-137405907 CAGAGGCCTCTGCCTGGCATTGG - Intronic
1185778828 X:2828906-2828928 CAGAGGCCAATCGCTGCCCTCGG + Exonic
1187475482 X:19607230-19607252 CAGAGGCCACGCAAAAGCCTGGG + Intronic
1187601610 X:20838504-20838526 CCAAGTCCATTCCCAGGCCTCGG + Intergenic
1189994817 X:46628286-46628308 GGGAGGCCACCCCCAGGGCTGGG + Intronic
1190392553 X:49946614-49946636 GAGAAGCCACTCCCATGACTAGG - Intronic
1195094000 X:101488880-101488902 CAGAGCCAACTCTCAGGCCAAGG + Exonic
1195870337 X:109479088-109479110 CAGTGGGCAGTCCCAGGGCTAGG - Intronic
1196177295 X:112653283-112653305 CAATGGAGACTCCCAGGCCTGGG + Intronic
1196747919 X:119088055-119088077 CAGATGCCTTTCCCAGCCCTCGG - Exonic
1197481825 X:126995740-126995762 TGGTGGCCACTGCCAGGCCTAGG - Intergenic
1198806526 X:140500562-140500584 GAGAGTACCCTCCCAGGCCTGGG + Intergenic
1199672034 X:150155560-150155582 CAGAGGCCCCACCCAGGACTGGG + Intergenic
1200039719 X:153356157-153356179 CAGTGGCCACCCAGAGGCCTGGG - Intronic
1200920930 Y:8612314-8612336 CAGAGGCCACTGCGAGGCCCAGG + Intergenic