ID: 1102927764

View in Genome Browser
Species Human (GRCh38)
Location 12:116839639-116839661
Sequence TGGATGGGTGAGTGTAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1092
Summary {0: 1, 1: 0, 2: 6, 3: 103, 4: 982}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102927762_1102927764 -10 Left 1102927762 12:116839626-116839648 CCAAGTGGAGGAGTGGATGGGTG 0: 1
1: 0
2: 1
3: 23
4: 255
Right 1102927764 12:116839639-116839661 TGGATGGGTGAGTGTAAAGGTGG 0: 1
1: 0
2: 6
3: 103
4: 982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102927764 Original CRISPR TGGATGGGTGAGTGTAAAGG TGG Intronic
900078236 1:835134-835156 TGAATGGGTGGGTGAACAGGGGG - Intergenic
900194232 1:1366535-1366557 AGGATTGGTGAGTGTGAATGTGG + Intergenic
900509332 1:3051169-3051191 TGGATGGATGAGTGGATGGGTGG - Intergenic
900509342 1:3051203-3051225 TGGATGGGTGAGTGGATGGTGGG - Intergenic
900509374 1:3051319-3051341 AGGATGGGTGAATGGAGAGGTGG - Intergenic
900509500 1:3051832-3051854 TGGATGGGTGGGTGGATGGGTGG - Intergenic
900509515 1:3051875-3051897 TGGATGGGTGAGTGGATGGATGG - Intergenic
900535850 1:3176908-3176930 TGGATGGATGAGTGGATAGATGG - Intronic
900640135 1:3684571-3684593 GGGGTGGGGGAGTGTAGAGGTGG + Intronic
900650106 1:3726353-3726375 TGGATGGGTGGGTGGATAGATGG + Intronic
900726317 1:4218633-4218655 TGGATGGGCCAGTCTAGAGGTGG + Intergenic
900747828 1:4373215-4373237 TGGATGGGTGGGTGGATGGGTGG - Intergenic
900783966 1:4636150-4636172 TGGATGGGTGTGTGTGCAGGTGG - Intergenic
901224868 1:7607372-7607394 TGGATGGATGGGTGAATAGGTGG + Intronic
901233536 1:7654715-7654737 TGTGTGGGTGTGTGTATAGGTGG - Intronic
901233576 1:7655036-7655058 TGTATAGGTGTGTGTATAGGTGG - Intronic
901233589 1:7655142-7655164 TGTATAGGTGTGTGTATAGGTGG - Intronic
901317934 1:8321686-8321708 TAGATGGGTGAGTGGAAGGATGG + Intronic
901318011 1:8322024-8322046 TGGATGGGTGAGTGGGTGGGTGG + Intronic
901831379 1:11894506-11894528 TGGATGGGTGGGTGGATGGGTGG + Intergenic
902108007 1:14053759-14053781 TGGATGTCTGACTGTGAAGGAGG - Intergenic
902176135 1:14652577-14652599 TGGGTGGGTGAGTAGATAGGTGG - Intronic
902176144 1:14652621-14652643 TGGATGGGTGGGTGGATGGGTGG - Intronic
902398028 1:16143006-16143028 TGGATGGATGGGTGGATAGGTGG + Intronic
902398091 1:16143233-16143255 TGGATGGATGAGTGGATGGGTGG + Intronic
902413314 1:16224942-16224964 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
902655007 1:17860918-17860940 TGGATGGATGGGTGGAGAGGTGG - Intergenic
902731466 1:18372679-18372701 TGGATGGATGAGTGTTTAGATGG + Intronic
902731474 1:18372715-18372737 TGGATGGATGAGTGTTTAGATGG + Intronic
902878005 1:19352623-19352645 TGGATGTGTGTGAGGAAAGGCGG - Intronic
902933134 1:19745305-19745327 TGGATGGGTGGATGGACAGGTGG + Intronic
903066675 1:20703557-20703579 TGGATGGATGAGTGTGCAGATGG + Intronic
903181024 1:21604922-21604944 TGGATGGGTGGGTGGATGGGTGG + Intronic
903277369 1:22230814-22230836 TGGATGGGTGGGTGGACAGACGG - Intergenic
903277472 1:22231214-22231236 TGGATGGGTGGGTGGACAGACGG - Intergenic
903359851 1:22770096-22770118 TGGATAGGTGAGTGTGTGGGTGG + Intronic
903384565 1:22917963-22917985 TGGATGGGCCAGTGGAACGGGGG + Intergenic
903726215 1:25447677-25447699 TGCATGAGTGAGTGTAAAAAAGG + Intronic
903772583 1:25773254-25773276 TGGATGGGTGAGTAGATAGATGG + Intronic
904720734 1:32506203-32506225 GGGATGGGAGAGTGTAAAGGAGG + Intronic
904819623 1:33233375-33233397 GGGATGGGTGAGGGAAAAGCAGG - Intergenic
905228253 1:36493916-36493938 TGGATAGGTGAGTGCATGGGTGG - Intergenic
905272050 1:36793715-36793737 TGGATGGGTGGATGGATAGGTGG + Intergenic
905359375 1:37408401-37408423 TGGATGGGTGGGTGGGCAGGTGG + Intergenic
905782585 1:40725610-40725632 TGGATGGATGAGGGAAAGGGGGG - Intronic
905871657 1:41407875-41407897 GGGGTGGGTGAGTGTAGAGGAGG + Intergenic
906091149 1:43180728-43180750 AGGAAGGGTGAGTGCAAGGGAGG + Intronic
906676905 1:47699791-47699813 TGGATGGATGAATGGAATGGTGG + Intergenic
906700461 1:47853655-47853677 TGGATGGGTGAGTGGATGGTAGG - Intronic
907732689 1:57083129-57083151 TTGATGGGTGAGTGGAAGTGAGG - Intronic
907946769 1:59142822-59142844 TGGATGGATGAATGGAAAGGTGG + Intergenic
907967202 1:59343948-59343970 TGGGTGGGTGAGTGTTGAAGGGG - Intronic
908900132 1:68947010-68947032 TGCATGGATGGGTGTAAATGGGG - Intergenic
909238521 1:73181880-73181902 GGGATGGATGGGGGTAAAGGAGG + Intergenic
910181652 1:84490890-84490912 TAGATGGATGAGGGTGAAGGAGG + Intronic
911053332 1:93690892-93690914 TTCAAGGGTGAGTGGAAAGGGGG + Intronic
912077007 1:105887461-105887483 TGGATGGATGAGTGGACAGAAGG + Intergenic
915067342 1:153236539-153236561 TAGATAGGAAAGTGTAAAGGTGG + Intergenic
916276661 1:163001401-163001423 GGGCTGGGTGATTGTATAGGTGG - Intergenic
916432934 1:164749672-164749694 TGGATGGGTGAGTGGATGGATGG + Intronic
916494757 1:165336461-165336483 AGGAAGGGGAAGTGTAAAGGAGG - Intronic
920570969 1:207017128-207017150 TGGATGGATGAGTGGATAGATGG - Intronic
922070522 1:222188140-222188162 TGGATGGGAGAGTGTGCAGAAGG + Intergenic
922401563 1:225263420-225263442 TAGATTGGTGAGAGGAAAGGGGG - Intronic
922449994 1:225729278-225729300 GAGATGGGTGAGTGGAGAGGGGG - Intergenic
922571438 1:226636700-226636722 TGGGTGGGTGGGTGTGAAGCGGG - Intronic
922792996 1:228320795-228320817 TGGATGGGTGAATGAGTAGGTGG - Intronic
923341935 1:233015100-233015122 TGCATTGGAGAGTGTTAAGGTGG - Intronic
1062790858 10:305197-305219 TGCATGGGTGAGTGTGATGTGGG - Intronic
1062943709 10:1444333-1444355 TGGATGGGTGAGTGGATGGCTGG - Intronic
1062943842 10:1445008-1445030 TGGATGGGTGAGTGGATGGACGG - Intronic
1062943926 10:1445453-1445475 TGGATGGGTGGGTGGATGGGTGG - Intronic
1062983616 10:1746050-1746072 TGGGTGGGTGCCTGTGAAGGTGG + Intergenic
1063073284 10:2688964-2688986 TGGATGGGTGAGTGGATGGATGG - Intergenic
1063140771 10:3254469-3254491 TGGGTGGGTGAGTGGAGGGGCGG - Intergenic
1063589080 10:7378503-7378525 TGGATGGGTGGGTGGATAGATGG + Intronic
1063993592 10:11594546-11594568 AGGAAGGGGGATTGTAAAGGTGG - Intronic
1064897519 10:20255166-20255188 TGGATGGATGGGTGGATAGGTGG + Intronic
1067363995 10:45608107-45608129 TAGATGGGGGAGGGAAAAGGGGG + Intergenic
1067537617 10:47125526-47125548 GGGAGGGGTGTGTGTAAAGTTGG + Intergenic
1067701556 10:48576883-48576905 GGGATGGGTGAGTGGAGAAGGGG - Intronic
1067751914 10:48977413-48977435 TGGATGGATGAGTGGATGGGTGG - Intronic
1069490727 10:68858203-68858225 TGGATGGCTTAGTGTGAAGAAGG + Intronic
1070661225 10:78306769-78306791 TTGATGAGTGAGTGGAAAAGAGG + Intergenic
1071445896 10:85746750-85746772 TGGATGGGTGACTTTAACTGAGG - Intronic
1071509064 10:86249994-86250016 TGGATGGGTGGGTGGAAGGATGG + Intronic
1071719325 10:88127497-88127519 TGCATGGGAGACTTTAAAGGAGG + Intergenic
1073959817 10:108912674-108912696 TGGGGGCGGGAGTGTAAAGGAGG + Intergenic
1074103612 10:110373263-110373285 TGGAGGGGTGAGTAATAAGGAGG + Intergenic
1074936077 10:118182655-118182677 TGGATGGGTGAATGGATGGGTGG + Intergenic
1074943819 10:118261035-118261057 TGGATGGATGAGTGAATAGGTGG - Intergenic
1074964095 10:118473475-118473497 TGGGTGTGTGTGTGTAAAAGAGG - Intergenic
1075723227 10:124599152-124599174 TGGATGGGTGAGTGGACAGATGG - Intronic
1076136740 10:128050310-128050332 TGGATGGATGAGTGGGAGGGCGG + Intronic
1076230493 10:128816474-128816496 TAGATGGGTGAGTGGATGGGTGG + Intergenic
1076278187 10:129223843-129223865 TGGGTGGGTGAGTGTGTGGGTGG + Intergenic
1076278203 10:129223914-129223936 TGGGTGGGTGAGTGTGTGGGTGG + Intergenic
1076278254 10:129224137-129224159 TGGATGGGTGGGTGAGTAGGTGG + Intergenic
1076293354 10:129364990-129365012 TTGCTGGGTCAGTGTGAAGGTGG - Intergenic
1076577988 10:131483614-131483636 TGGATGGGTGAGTGGACGGATGG + Intergenic
1076837531 10:133028634-133028656 TGGATGGATGGGTGGATAGGTGG + Intergenic
1076845037 10:133065763-133065785 TGGATGAGTGAGTGGATGGGTGG + Intergenic
1076845042 10:133065775-133065797 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1076867369 10:133174683-133174705 TGGATGGGTGGGTAGATAGGTGG + Intronic
1076867438 10:133175008-133175030 TGGATGGGTGGGTGGAAAGATGG + Intronic
1076867454 10:133175064-133175086 TGGATGGGTGGGTGGATGGGTGG + Intronic
1076867496 10:133175240-133175262 TGGATGGGTGGGTGGATAGATGG + Intronic
1076867630 10:133175835-133175857 TGGATGGGTGAGTGGACGTGTGG + Intronic
1076867687 10:133176051-133176073 TGGGTGGGTGAGTGGATAGGTGG + Intronic
1076992460 11:282556-282578 TGGTTGGGGGAGTGTGAAGGGGG + Intronic
1077150282 11:1070084-1070106 TGGATGGGTGAGTGGATGGATGG - Intergenic
1077159532 11:1106387-1106409 TGGATGGGTGGATGGATAGGTGG - Intergenic
1077159558 11:1106481-1106503 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1077294940 11:1821944-1821966 TGGATGGTTGAGTGGATAGATGG + Intergenic
1077304294 11:1861980-1862002 TGGATGGGTGAATGGATGGGTGG + Intronic
1077304308 11:1862048-1862070 TGGATGGATGAGTGGATGGGTGG + Intronic
1077312083 11:1893378-1893400 TGGATGAGTGGGTGAATAGGTGG + Intergenic
1077319072 11:1932900-1932922 TGAATGGGTGAGTGGATACGTGG - Intronic
1077357726 11:2126486-2126508 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1078883763 11:15479259-15479281 TAGATGGGTGAGTGTATGGAAGG - Intergenic
1080559288 11:33447514-33447536 TAGATGGGTGAGTGGAAGGATGG - Intergenic
1080689174 11:34541539-34541561 TGCAGGAGTGAATGTAAAGGAGG - Intergenic
1080826949 11:35856425-35856447 TGGATGGGTGGGTGGACGGGTGG + Intergenic
1081319872 11:41679054-41679076 AGGATGGGTGCATATAAAGGAGG + Intergenic
1082025282 11:47566723-47566745 GGGAGGGGAGAGTGTTAAGGGGG - Intronic
1083201281 11:61122476-61122498 TGGATGGGTGAGTGGATGGATGG + Intronic
1083634663 11:64113985-64114007 TGGATGGATGAATGGACAGGTGG + Intronic
1083634736 11:64114382-64114404 TGGATGGGTGAATGGACAGGTGG + Intronic
1083634787 11:64114644-64114666 TGGATGGATGAATGGACAGGTGG + Intronic
1083634805 11:64114764-64114786 TGGATGGATGAATGTACAGGTGG + Intronic
1083742807 11:64720143-64720165 TGGTGGGGTGAGGGTGAAGGTGG - Intronic
1083828503 11:65216718-65216740 TGGATGGGTGAGTGGGTGGGTGG + Intergenic
1084115979 11:67043175-67043197 TGGATGGGTGGATGGAAGGGAGG - Intronic
1084303140 11:68264414-68264436 TGGATGGGTGAGTGGATGGATGG - Intronic
1084413462 11:69016975-69016997 TGGATGGGTGAGTGGGTGGGTGG - Intergenic
1084455019 11:69263405-69263427 TGGATGGGTGAGTGGATGGATGG - Intergenic
1084457291 11:69275350-69275372 TGGATGGATGAGTGTATAGGTGG - Intergenic
1084494882 11:69497970-69497992 TGGAGGGGTGTGGGTATAGGTGG + Intergenic
1084494931 11:69498150-69498172 TGGAGGGGTGCATGTATAGGTGG + Intergenic
1084495014 11:69498470-69498492 CGGATGGGTGTGGGTATAGGTGG + Intergenic
1084545905 11:69815020-69815042 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1084545913 11:69815044-69815066 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1084545919 11:69815072-69815094 TGGATGGGTGAGTGGATGAGTGG + Intronic
1084546003 11:69815355-69815377 TGGATGGGTGAGTGGATGGGAGG + Intronic
1084615942 11:70235993-70236015 TTGATGGGGCAGTGGAAAGGTGG + Intergenic
1084684516 11:70685931-70685953 TGGATGGGTGAGTGGGTGGGTGG - Intronic
1084684527 11:70685967-70685989 TGGATGGATGAGTGCATGGGTGG - Intronic
1084684545 11:70686039-70686061 TGGATGGGTGTGTGGATGGGTGG - Intronic
1084684569 11:70686130-70686152 TGGATGGGTGTGTGGATGGGTGG - Intronic
1084684602 11:70686246-70686268 TGGATGGGTGTGTGGATGGGTGG - Intronic
1084684623 11:70686341-70686363 TGGATGGGTGTGTGAATGGGTGG - Intronic
1084697523 11:70764529-70764551 TGGATGGGTGGGTGGATGGGTGG - Intronic
1084697563 11:70764724-70764746 TGGATGGGTGAGTGGGTAGATGG - Intronic
1084699410 11:70776774-70776796 TGGATGGGTGAATGGATGGGTGG - Intronic
1084713082 11:70856255-70856277 TGGATGGGTGAGTGAATAAGTGG + Intronic
1084781816 11:71414848-71414870 TGGATGGGTGGGTGGATAGATGG + Intergenic
1084781867 11:71415066-71415088 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1084781870 11:71415078-71415100 TGGATGGGTGGGTGGATAGATGG + Intergenic
1084785680 11:71440470-71440492 TGGATGGGTGGGTGGGTAGGTGG + Intronic
1084940867 11:72612617-72612639 TGGATGGATGAGTGGGTAGGTGG + Intronic
1084985469 11:72866936-72866958 TGGATGGGTGAGTGGCTAGTTGG - Intronic
1085308136 11:75500054-75500076 TGGAGGGCTGAGGGTGAAGGAGG - Intronic
1085464296 11:76713579-76713601 TGGATGGATGAGTGAATGGGTGG + Intergenic
1085464363 11:76713803-76713825 TGGATGGGTGAGTAGATGGGTGG + Intergenic
1085528556 11:77178217-77178239 TGGATGGATGGGTGAATAGGTGG - Intronic
1085528570 11:77178265-77178287 TGGATGGATGAGTGACTAGGTGG - Intronic
1085763144 11:79259621-79259643 TGGATGGGGGAGTGGATGGGTGG - Intronic
1086126066 11:83350060-83350082 TGGATAGGAGAGAATAAAGGGGG - Intergenic
1086491414 11:87360700-87360722 GGGAGGGGTGAGTCTAATGGTGG - Intergenic
1088884698 11:113997692-113997714 GGGATGTGTGAGTGGAAAAGAGG - Intergenic
1089020912 11:115213728-115213750 TGAATGTGTGTGTGTGAAGGGGG - Intronic
1089418682 11:118314941-118314963 TGTATGTGTGTGTGTAAGGGTGG - Intronic
1089580060 11:119476112-119476134 TGGGTGGGTGGGTGGAAAGATGG + Intergenic
1089808697 11:121114593-121114615 TGGATGGGTGGGTGGATGGGTGG - Intronic
1089808706 11:121114617-121114639 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1089808711 11:121114629-121114651 TGGATGGGTGGGTGGATGGGTGG - Intronic
1089808720 11:121114653-121114675 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1089808725 11:121114665-121114687 TGGATGGGTGGGTGGATGGGTGG - Intronic
1089808738 11:121114701-121114723 TGGATGGGTGGGTGAATGGGTGG - Intronic
1089808747 11:121114733-121114755 TGGATGGGTGGGTGAATGGGTGG - Intronic
1089808760 11:121114769-121114791 TGGATGGGTGAGTGAATGGGTGG - Intronic
1089808765 11:121114789-121114811 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1089808770 11:121114801-121114823 TGGATGGGTGGGTGGATGGGTGG - Intronic
1089808814 11:121114953-121114975 TGGATGGGTGGGTGAATGGGTGG - Intronic
1089808846 11:121115069-121115091 TGGATGGGTGGGTGAATGGGTGG - Intronic
1089808867 11:121115149-121115171 TGGATGGGTGGGTGAATGGGTGG - Intronic
1089808888 11:121115217-121115239 TGGATGGGTGGGTGAATGGGTGG - Intronic
1091187382 11:133658549-133658571 TGGGTGGGTGGGTGTATAGATGG + Intergenic
1091670063 12:2446385-2446407 TGGATGGGTGGATGGATAGGTGG + Intronic
1092082148 12:5725142-5725164 TGGATGGGTGAGTGTGCCAGTGG - Intronic
1092815431 12:12308585-12308607 TGAATGGGTGAGTGAAATGAAGG + Intergenic
1093577553 12:20751301-20751323 TGTGTGGGTGAGTGTATATGGGG + Intronic
1095309477 12:40680851-40680873 TAGATGAGTGAGTGAAATGGAGG + Intergenic
1095733865 12:45535644-45535666 TGGATGGATGGGTGGATAGGTGG - Intergenic
1095733907 12:45535824-45535846 TGGATGGGTGAATGAATGGGTGG - Intergenic
1095733915 12:45535852-45535874 TGGATGGGTGGATGGATAGGTGG - Intergenic
1096874329 12:54615452-54615474 TGGATGGGTGAGTGATCACGAGG - Intergenic
1097093709 12:56528324-56528346 TGAATTTGTTAGTGTAAAGGTGG + Intronic
1097724053 12:63053936-63053958 AGAGTGGGTGAGTGGAAAGGTGG + Intergenic
1098454481 12:70656688-70656710 TGGATAGGTGAGTGTCACAGAGG - Exonic
1099177417 12:79437929-79437951 GGGATGGGAGAGAATAAAGGAGG + Intronic
1101834790 12:108287591-108287613 TGAATGGGTGGGTGGATAGGTGG + Intergenic
1102042497 12:109809574-109809596 TGGATGGGTGAGTGGATGGATGG - Intronic
1102199742 12:111049092-111049114 TGGATGGATGAGTGGACAGATGG - Intronic
1102207702 12:111101545-111101567 TGGGTGGGTGAGTGGGTAGGGGG + Intronic
1102504204 12:113373636-113373658 TGGATGAGTGAGTGAATAGATGG - Intronic
1102507101 12:113390535-113390557 TGGATGGATGAGTGAATGGGTGG - Exonic
1102507109 12:113390578-113390600 TGGATGGGTGAGTGGGTAGATGG - Exonic
1102507134 12:113390714-113390736 TGGATGGGTGAGTGGGTAGATGG - Exonic
1102514523 12:113437393-113437415 TATATGAGTGAGTGGAAAGGTGG + Intronic
1102640221 12:114360589-114360611 TGGATGGATAAGTGGATAGGTGG + Intronic
1102873797 12:116434376-116434398 TGGAGGGGTGAGTTTAGCGGTGG - Intergenic
1102927764 12:116839639-116839661 TGGATGGGTGAGTGTAAAGGTGG + Intronic
1102927784 12:116839739-116839761 TGGGTGGGTGAATGGATAGGTGG + Intronic
1103004376 12:117409436-117409458 TGGAGGGGTGAGTGGATAGAGGG + Intronic
1103004422 12:117409606-117409628 TGGATAGGTGAATGGAGAGGTGG + Intronic
1103004432 12:117409638-117409660 TGGATGGATGAGTGGATAGAGGG + Intronic
1103017736 12:117508777-117508799 TGGATGGGTGGCTGGATAGGTGG + Intronic
1103027239 12:117583458-117583480 TGGATGGGTGAATGGAAAGATGG + Intronic
1103056587 12:117825956-117825978 TGGATGGGTGGGTGGGTAGGTGG + Intronic
1103101910 12:118183992-118184014 TGGGTGGGTGTCTGTAAAGAGGG + Intronic
1103849717 12:123924654-123924676 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1103908352 12:124338935-124338957 TGGGTGGGTGAGAGTATAGATGG - Intronic
1104092319 12:125527026-125527048 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092341 12:125527094-125527116 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092382 12:125527226-125527248 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092416 12:125527333-125527355 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092455 12:125527460-125527482 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092462 12:125527480-125527502 TGGATGGGTGGTTGGAAGGGTGG - Intronic
1104092476 12:125527528-125527550 TGGATGGGTGGTTGGAAGGGTGG - Intronic
1104092483 12:125527548-125527570 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092508 12:125527628-125527650 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104092529 12:125527696-125527718 TGGATGGGTGGATGGAAGGGTGG - Intronic
1104778621 12:131405439-131405461 TGGATGGATGGGTGGAAGGGTGG - Intergenic
1104778663 12:131405600-131405622 TGGATGGGTGAGTGGATGGCTGG - Intergenic
1104925766 12:132313325-132313347 TGGATGGGTGAGTGGATGGGTGG - Intronic
1104925896 12:132313786-132313808 TGGATGGGTGGGTGGATGGGTGG - Intronic
1104942654 12:132402185-132402207 TGAATGGGTGAGTGGATAGGTGG - Intergenic
1104942670 12:132402249-132402271 TGGATGGGTGTGTAGACAGGTGG - Intergenic
1104954480 12:132457624-132457646 TGGGTGGGTGAGTGGACGGGCGG + Intergenic
1104954518 12:132457746-132457768 TGGGTGGGTGAGTGGACAGGTGG + Intergenic
1104954561 12:132457878-132457900 TGGGTGGGTGAGTGGACGGGTGG + Intergenic
1104954586 12:132457954-132457976 TGGGTGGGTGAGTGGACGGGTGG + Intergenic
1105279810 13:18956869-18956891 TGGATGGATGAGTGGATAGATGG - Intergenic
1105586020 13:21743480-21743502 TGAATGGGTGAGTGGATGGGTGG - Intergenic
1107991958 13:45826486-45826508 TGGATGGGTGGGTGGATAGATGG + Intronic
1109759418 13:66807953-66807975 TGGGTGGTTGAGTGTTATGGGGG + Intronic
1110090179 13:71435117-71435139 TTAATGGGGGAGTGTAAAGTCGG - Intergenic
1111719142 13:91919271-91919293 TGGATGAGTGATTGTAAAATTGG - Intronic
1112675406 13:101695640-101695662 TGGATGGAAGACAGTAAAGGTGG + Intronic
1113340285 13:109416284-109416306 TGGATGGGCGGGTGAAGAGGAGG - Intergenic
1113581731 13:111434830-111434852 TGGATGGGTGGGTGGATATGTGG + Intergenic
1113581804 13:111435209-111435231 TGGATGGGTGAGTGTGTGTGTGG + Intergenic
1113780206 13:112972435-112972457 TGGGTGGATGAATGTAAGGGTGG + Intronic
1113912629 13:113850887-113850909 TGGATGGATGAGTGAATCGGTGG + Intronic
1114672778 14:24420716-24420738 TGGAAGGCTGACTGGAAAGGTGG - Intergenic
1114996358 14:28357247-28357269 TGGTTATGTGAGTGTCAAGGGGG + Intergenic
1118554021 14:66993254-66993276 TGTATGTGTGTGTGTAGAGGGGG - Intronic
1119356500 14:74011449-74011471 TGTATATGTGTGTGTAAAGGTGG + Intronic
1119535177 14:75396998-75397020 TGCATGTGTGAGTGTGTAGGTGG + Intergenic
1119811133 14:77520514-77520536 TGGATGGGTGAGTTTTGAGCTGG - Intronic
1120008123 14:79382995-79383017 TGGGTGGGTGAGGGTGGAGGAGG + Intronic
1121087455 14:91157276-91157298 TGGATGGGTGGGTGGATAGATGG + Intronic
1121277479 14:92678078-92678100 TGGATGGGTGAATGGATGGGTGG - Intronic
1121277511 14:92678206-92678228 TGGATGGGTGGGTGAATGGGTGG - Intronic
1121277521 14:92678246-92678268 TGGATGGGTGGGTGGTTAGGTGG - Intronic
1121277564 14:92678417-92678439 TGGATGGGTGAATGAATATGTGG - Intronic
1121485141 14:94308982-94309004 TGGATGGGTGAGTGAATGGATGG - Intronic
1121724048 14:96133258-96133280 TGGATGGGTGGGTGCATAGATGG - Intergenic
1121768118 14:96504914-96504936 TGGATGGGTGAGTGGCATTGGGG + Intronic
1121815923 14:96928737-96928759 TGGATGGGTGGATGGATAGGGGG - Intronic
1121816008 14:96929096-96929118 TGGATAGGTGGATGGAAAGGGGG - Intronic
1121816013 14:96929108-96929130 TGGATGGGTGAATGGATAGGTGG - Intronic
1121878844 14:97480960-97480982 GGCTTGGGTGAGTGTAAATGTGG + Intergenic
1121912252 14:97802227-97802249 TGGATGGGTGAGTGGATGGTTGG + Intergenic
1122355012 14:101117732-101117754 TGGATGGATGGGTGGAAAAGTGG - Intergenic
1122365108 14:101190367-101190389 TGGACGGGTGAGTGTATGGATGG + Intergenic
1122428633 14:101626054-101626076 TGGATGGGTGGATGGATAGGTGG + Intergenic
1122741666 14:103875211-103875233 TGGATGGATAAATGGAAAGGTGG + Intergenic
1122741870 14:103876046-103876068 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1122795633 14:104204854-104204876 TGGATGGGTGCATGGAAAGATGG - Intergenic
1122877496 14:104675576-104675598 TGGATGGATGGGTGGATAGGTGG + Intergenic
1122877529 14:104675710-104675732 TGGATGGGTGAGTGGATGGATGG + Intergenic
1122879771 14:104685573-104685595 TGGATGGGTGGATGAAAGGGTGG + Intergenic
1122879952 14:104686220-104686242 TGGATGTGTGAGTGGATAGGTGG + Intergenic
1122923680 14:104890299-104890321 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1122923714 14:104890439-104890461 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1122923751 14:104890583-104890605 TGGATGGGTGAGTGAGTGGGTGG + Intronic
1122923776 14:104890679-104890701 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1123117459 14:105901120-105901142 TGGCTGGGTGAGTGTCACTGTGG + Intergenic
1123126059 14:105947064-105947086 TGGACGGGTGAGTGGATGGGTGG - Intergenic
1123406644 15:20023486-20023508 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1123515974 15:21030134-21030156 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1123934486 15:25187501-25187523 TGGATGGGTGTGTGTGGTGGGGG + Intergenic
1123986216 15:25648526-25648548 TGGATGGGTGGGTGGAGAGATGG + Intergenic
1124395775 15:29300201-29300223 TGGGTGGGTGGGTGTACAGATGG + Intronic
1125580696 15:40783399-40783421 GGGATGGGTGAGAGGAAGGGAGG + Intronic
1126176187 15:45737904-45737926 TGGATGGGTGGGTGGATAGTTGG + Intergenic
1126235775 15:46382475-46382497 TTGAAGGGGGAGTGTAAGGGAGG + Intergenic
1126618397 15:50610986-50611008 TTGATGTGTGAGTGTAATGGTGG - Intronic
1127656192 15:61058336-61058358 TGGATGAGTGAATGTGCAGGCGG + Intronic
1127872199 15:63083023-63083045 TGGATGGCTGACTGTAAAATAGG - Intergenic
1128666896 15:69544924-69544946 TGGCTGGGTGAGTGTAGAGCAGG + Intergenic
1129004248 15:72358924-72358946 TGGGCGGGTGTGTGTAGAGGCGG - Intronic
1129603245 15:77012369-77012391 TGGATGGATGGGTGGATAGGTGG - Intronic
1130649368 15:85753453-85753475 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1131459966 15:92611037-92611059 TGGATGGATGGGTGGGAAGGAGG + Intergenic
1131481627 15:92787284-92787306 TGAATGAATGAGTGCAAAGGGGG - Intronic
1131993071 15:98109191-98109213 TGGATGAGTGAATGAAAAGTGGG + Intergenic
1132337290 15:101056486-101056508 TGGATGGGTGGATGGAAAAGAGG + Intronic
1132351479 15:101142166-101142188 TGGGTGTGTGAGTGGATAGGTGG - Intergenic
1132351505 15:101142305-101142327 TGGATAGGTGAGTGGAGGGGTGG - Intergenic
1132351521 15:101142369-101142391 TGGATGGGAGGGTGAATAGGTGG - Intergenic
1132351530 15:101142397-101142419 TGGATGGTTGAGTGAATAGGTGG - Intergenic
1132351547 15:101142473-101142495 TGGATGGATAAGTGGATAGGTGG - Intergenic
1132644704 16:993585-993607 TGGATGGGTGAGTGGATGGATGG - Intergenic
1132644721 16:993645-993667 TGGATGGGTGAGTGGGTGGGTGG - Intergenic
1132644753 16:993757-993779 TGGATGGGTGAGTAAATGGGTGG - Intergenic
1132644775 16:993833-993855 TGGATGGGTGAGTGAGTGGGTGG - Intergenic
1133111610 16:3551280-3551302 TGGATGGGTGAGTGGATAGATGG - Intronic
1133204729 16:4226488-4226510 TGGGTGGGTGAGTGGAAGGATGG + Intronic
1133416561 16:5611754-5611776 TGGATGGGAGACTGAAAAGAAGG - Intergenic
1133441855 16:5827917-5827939 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1133441899 16:5828121-5828143 TGGATGGATGGGTGGATAGGTGG - Intergenic
1133456096 16:5943805-5943827 TGGATGGGTGAGTGGGTAGGTGG - Intergenic
1133456135 16:5943979-5944001 TGGATGGGTGGATGGAAAGATGG - Intergenic
1133456140 16:5943999-5944021 TGGATGGGTGAGTGGATGGATGG - Intergenic
1133462680 16:6000746-6000768 TGGATGGATGAGTGGGTAGGTGG + Intergenic
1133469311 16:6058709-6058731 TGGATGGGTGGGTGGATGGGTGG - Intronic
1133469322 16:6058741-6058763 TGGATGAGTGAATGGATAGGTGG - Intronic
1133500904 16:6365449-6365471 TGGATGGGTGAATGGATGGGTGG + Intronic
1133534374 16:6686763-6686785 GGGTTGGGTGTGTGTAATGGGGG - Intronic
1133614031 16:7459067-7459089 TGGATGGGTGAGTGGATGGATGG + Intronic
1133739589 16:8641007-8641029 TGGATGGGTGAGAGCAAGGGTGG + Intronic
1134033027 16:11007811-11007833 TGTATGTGTGTGTGTAATGGTGG + Intronic
1134106976 16:11492282-11492304 TGGATGGGTGAATGGATAGATGG - Intronic
1134224799 16:12381641-12381663 TGGGTGGGTGGGTGGATAGGTGG - Intronic
1134446990 16:14338388-14338410 TGGATGGATGAATGGATAGGTGG - Intergenic
1134447035 16:14338544-14338566 TGGATGGGTGAATGGATAGGTGG - Intergenic
1134636957 16:15799981-15800003 TAGATGGGTGAATGGAAGGGTGG + Intronic
1134637078 16:15800544-15800566 TGGATGGGTGGGTGAATGGGAGG + Intronic
1134739844 16:16532913-16532935 TGGATGGATGAGTGAATAGATGG - Intergenic
1134766893 16:16767097-16767119 TGGATGGGTGGATGGATAGGTGG - Intergenic
1134800998 16:17084637-17084659 TGGATGGATGAATGGACAGGTGG - Intergenic
1134927655 16:18179251-18179273 TGGATGGATGAGTGAATAGATGG + Intergenic
1134998825 16:18759800-18759822 TGGGTGGGTGAGTGGAGAGTAGG + Intergenic
1135176928 16:20238432-20238454 TGGATGGATGAATGGAAGGGTGG - Intergenic
1135331396 16:21562975-21562997 TGTATGGGAGAGAGAAAAGGAGG - Intergenic
1135614329 16:23897841-23897863 TGGATGGGTGGGTGGATGGGTGG - Intronic
1135892951 16:26373927-26373949 TGGATGGGAGAGTGAGTAGGTGG + Intergenic
1135892995 16:26374141-26374163 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1135933244 16:26757305-26757327 TGGATGGCTGAGTGGAAGGATGG + Intergenic
1135933279 16:26757481-26757503 TGGATGTGTGGGTGGATAGGTGG + Intergenic
1135942822 16:26837551-26837573 TGGATGGATGGGTGGATAGGAGG - Intergenic
1136115815 16:28093614-28093636 TGGAGGGGTGAGGGAGAAGGAGG + Intergenic
1136279095 16:29197609-29197631 TGGATGGGTGAGTGAATGGATGG + Intergenic
1136279207 16:29198106-29198128 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1136607975 16:31349289-31349311 TGGGTGGGTGGGTGAACAGGTGG - Intergenic
1136608007 16:31349389-31349411 TGGGTGGGTGGGTGAACAGGTGG - Intergenic
1137560151 16:49497187-49497209 TGGATGGGTGAGTGGATGGGTGG - Intronic
1137579836 16:49627142-49627164 TGGATGGATGGGTGGATAGGTGG - Intronic
1137580117 16:49628418-49628440 TGGATGGGTGGGTGTATGCGTGG - Intronic
1137926866 16:52547931-52547953 GGGGTGGGTGAGTGTAGAGTGGG - Intergenic
1138440303 16:57030317-57030339 TGGATGGGTGGATGAAAAGATGG + Intronic
1138440311 16:57030365-57030387 TGGATGGGTGGATGAAAAGATGG + Intronic
1138440322 16:57030421-57030443 TGGATGGGTGGATGAAAAGATGG + Intronic
1138440332 16:57030473-57030495 TGGATGGGTGGATGAAAAGATGG + Intronic
1138440350 16:57030597-57030619 TGGATAGGTGTGTGAAAAGATGG + Intronic
1138547602 16:57729071-57729093 TGGATGGATGAGTGGGTAGGTGG + Intronic
1138547714 16:57729527-57729549 TGGATGGGTGAGTGAGTGGGTGG + Intronic
1138547735 16:57729599-57729621 TGGATGGGTGAGTGAGTGGGTGG + Intronic
1138547772 16:57729715-57729737 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1138547774 16:57729735-57729757 TGGATGAGTGAGTGAGCAGGTGG + Intronic
1138547791 16:57729795-57729817 TGGATGGATGAGTGAGTAGGTGG + Intronic
1138547814 16:57729891-57729913 TGGATGAGTGAGTGAGTAGGTGG + Intronic
1138547836 16:57729963-57729985 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547842 16:57729991-57730013 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547847 16:57730019-57730041 TGGATGGATGAGTGGAAGGACGG + Intronic
1138547862 16:57730074-57730096 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1138547902 16:57730246-57730268 TGGATGAGTGAGTGAGTAGGTGG + Intronic
1138547925 16:57730322-57730344 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547931 16:57730350-57730372 TGGATGGGCGAGTGGATAGATGG + Intronic
1138547937 16:57730378-57730400 TGGATGGATGAGTGGAAGGACGG + Intronic
1139663351 16:68437526-68437548 TGGAAGGATGAGTGCAAGGGTGG - Intronic
1140564224 16:76022313-76022335 TGGATGGGTCAGGGTGAGGGAGG + Intergenic
1140771183 16:78205573-78205595 TGGGTGGGTGAGTGGAAGGGTGG - Intronic
1141178009 16:81733427-81733449 TGGATGGGTAGGTGGAAGGGTGG - Intergenic
1141430233 16:83967577-83967599 TGGATGGGAGGGTGTGTAGGTGG + Intergenic
1141488208 16:84355018-84355040 TGGATGGGTGAGTGGGTGGGTGG + Intergenic
1141488264 16:84355210-84355232 TGGACGGGTGTGTGGATAGGTGG + Intergenic
1141488273 16:84355242-84355264 TGGATGGATGAATGTATGGGTGG + Intergenic
1141488289 16:84355290-84355312 TGGATGGGTGGATGGAAGGGTGG + Intergenic
1141488374 16:84355575-84355597 TGGATGGGTGGGTGCACAGGTGG + Intergenic
1141650003 16:85387893-85387915 TGGATTTGTGAGTGGATAGGTGG + Intergenic
1141650023 16:85387969-85387991 TAGATGGGTGAGTGGATGGGTGG + Intergenic
1141650045 16:85388053-85388075 TAGATGGGTGAGTGGATGGGTGG + Intergenic
1141650098 16:85388269-85388291 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1141650118 16:85388349-85388371 TGGATGGGTGAGTGGATGGGCGG + Intergenic
1141650145 16:85388457-85388479 TAGATGGGTGAGTGGATGGGTGG + Intergenic
1141650173 16:85388565-85388587 TAGATGGGTGAGTGGATGGGTGG + Intergenic
1141657943 16:85426080-85426102 TGGATGGGTGAATGAGAGGGAGG + Intergenic
1141658077 16:85426648-85426670 TGGATGGGTGAATGGAAGGAAGG + Intergenic
1141690890 16:85595684-85595706 TGGGTGGGTGAGTGGATGGGAGG - Intergenic
1141823855 16:86465633-86465655 TGGATGGGTGGATGGAATGGTGG + Intergenic
1142083488 16:88163702-88163724 TGGATGGGTGAGTGAATGGATGG + Intergenic
1142083597 16:88164207-88164229 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142083620 16:88164331-88164353 TGGATGGGTGGATGTATAAGTGG + Intergenic
1142083634 16:88164406-88164428 TGGATGGGTGGATGTATAAGTGG + Intergenic
1142096781 16:88244294-88244316 TGGATGGGTGAGTGGATGGTTGG + Intergenic
1142096803 16:88244374-88244396 TGGATGGGTGAATGCATGGGTGG + Intergenic
1142124063 16:88401504-88401526 TGGATGGGTGAGTGGATGGATGG + Intergenic
1142124099 16:88401664-88401686 TGGATGGGTGAGTGCATGGATGG + Intergenic
1142124189 16:88402037-88402059 TGGATGGGTGAGTGCATGGATGG + Intergenic
1142128619 16:88422256-88422278 TGGATGGGTGGATGGATAGGTGG + Intergenic
1142128637 16:88422330-88422352 TGGATGGGTGAATGGGCAGGTGG + Intergenic
1142128680 16:88422472-88422494 TGGATGGGTGGGTGGATAGATGG + Intergenic
1142152578 16:88519174-88519196 TGGATGGGTGGGTGGATGGGAGG + Intronic
1142234574 16:88915619-88915641 TGGAGGGGGGAGTGTGGAGGAGG + Intronic
1142234589 16:88915659-88915681 TGGACGGGGGAGTGTGGAGGGGG + Intronic
1142248299 16:88979699-88979721 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142248647 16:88981008-88981030 TGGGTGGGTGGGTGGATAGGTGG + Intergenic
1142255365 16:89011357-89011379 TGGGTGGGTGAGTGTGTGGGTGG - Intergenic
1142255412 16:89011537-89011559 TGGGTGGGTGAGTGTGTGGGTGG - Intergenic
1142255594 16:89012299-89012321 TGGATGGGTGGGTGAATGGGTGG - Intergenic
1142255627 16:89012426-89012448 TGGATGGGTGGGTGAATGGGTGG - Intergenic
1143043359 17:4056274-4056296 TGGATGGATGAGTGTCAGGATGG - Exonic
1143804326 17:9413942-9413964 TGGATGGTTGAGTGGATAGGTGG - Intronic
1143908946 17:10231704-10231726 TGGATGGGTGAGTGTATTTATGG - Intergenic
1145240178 17:21236401-21236423 TGGATGGGTGGGTGGATAGATGG - Intergenic
1145240218 17:21236544-21236566 TGGATGGGTGTGTGGATAGGTGG - Intergenic
1145261440 17:21357081-21357103 TGGATGGATGAGTGGATGGGTGG - Intergenic
1145262515 17:21363133-21363155 TGGATGGATGAGTGGACAGATGG + Intergenic
1145271485 17:21407196-21407218 TGGATGGGTGGGTGGATGGGTGG - Intronic
1145271550 17:21407487-21407509 TGGATGGGTGAGTGAATGAGTGG - Intronic
1145309677 17:21694560-21694582 TGGGTGGATGAGTGTGAGGGTGG - Intronic
1145309699 17:21694644-21694666 TGGATGGGTGGGTGGATGGGTGG - Intronic
1145309764 17:21694935-21694957 TGGATGGGTGAGTGAATGAGTGG - Intronic
1146504715 17:33394961-33394983 TGGATGGGTGAATGGAAAAATGG - Intronic
1148095059 17:45046794-45046816 GAGATGGGTGAGTGTGAAGGAGG - Intronic
1148583361 17:48759190-48759212 TGGCTGGGGGAGAGAAAAGGAGG - Intergenic
1148634146 17:49134086-49134108 TTCATGGGTGACTGAAAAGGAGG + Intronic
1148736322 17:49867055-49867077 TGGATGGATGAGTGGGCAGGTGG + Intergenic
1149453711 17:56770410-56770432 TGGATGGGTGGATGGAAAGGTGG - Intergenic
1149453780 17:56770785-56770807 TGGGTGGGTGAGTGGAAATATGG - Intergenic
1149993085 17:61393564-61393586 GGGATGGGTGTGTGTGAAGGGGG - Intergenic
1150631383 17:66882750-66882772 TGGATTGGTGAGTGGATGGGCGG + Intronic
1150848158 17:68680062-68680084 TGGATGGATGGATGGAAAGGTGG - Intergenic
1150848444 17:68682488-68682510 TGGATGGGTGAGTGGACGGGGGG - Intergenic
1151144873 17:72031171-72031193 TGGGTGGGTGAGTTGAAAGATGG - Intergenic
1151973317 17:77470298-77470320 TGGATGGGTGAGTGGATGGGTGG - Intronic
1151973338 17:77470402-77470424 TGGATGGGTGAGTGGATGCGTGG - Intronic
1152007043 17:77688799-77688821 TGGATGGGTGGGTGGGAGGGTGG - Intergenic
1152038084 17:77885460-77885482 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
1152133239 17:78489836-78489858 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1152141636 17:78540516-78540538 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1152141727 17:78540852-78540874 TGGATGGGTGGGTGGATGGGTGG + Intronic
1152141732 17:78540864-78540886 TGGATGGGTGGGTGGATGGGTGG + Intronic
1152301623 17:79498361-79498383 TGGATGGATGAGTGGGCAGGTGG - Intronic
1152301638 17:79498433-79498455 TGGATGGGTGGGTGGAAGGATGG - Intronic
1152301717 17:79498767-79498789 TGGATGGATGAGTGTATGGATGG - Intronic
1152301841 17:79499449-79499471 TGGATGGGTGAGTGGGTAGATGG - Intronic
1152473450 17:80503116-80503138 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
1152475971 17:80518526-80518548 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1152766984 17:82147142-82147164 TGGATGGGTGAGTGAAAGGATGG + Intronic
1153227291 18:2908515-2908537 TGGATGGGTGGGTGCAGAAGTGG - Intronic
1153672008 18:7420456-7420478 TGGAAGGGTGAGGATGAAGGAGG - Intergenic
1153742629 18:8144908-8144930 TGGATGGGAGAAGGTAAAGGTGG + Intronic
1153944589 18:10008099-10008121 TGGATGGATGGATGGAAAGGTGG - Intergenic
1154138276 18:11800198-11800220 TGGATGGGTGAGTGGATGGATGG + Intronic
1154307790 18:13243430-13243452 TGGCTGGGTGGGTGTACAGGTGG - Intronic
1154307985 18:13244234-13244256 TGAGTGGGTGAGTGGACAGGAGG - Intronic
1154970108 18:21399498-21399520 TGGATGGGTGGGTGGATAGATGG + Intronic
1155234798 18:23808541-23808563 TGGATGGATGACTGTAAAATAGG + Intronic
1156534696 18:37851103-37851125 TGCAGGGGTGAGGGTAAAGTAGG - Intergenic
1156586168 18:38433612-38433634 AGGATGGGTAAGGGGAAAGGAGG + Intergenic
1156798604 18:41079945-41079967 GGGAGGGGTGAGTGGGAAGGGGG - Intergenic
1157299883 18:46472027-46472049 TGGATGGGTGGGTGAATGGGTGG - Intergenic
1157554297 18:48603175-48603197 TAGATGGGTGGGTGGATAGGTGG + Intronic
1157602207 18:48901282-48901304 TGGATGGATGAGTGGATAGATGG + Intergenic
1157703416 18:49780098-49780120 TGGATGGGTGAATGGATAGATGG - Intergenic
1158032123 18:52978730-52978752 TGGATAGGAGACTGTAAAGCGGG - Intronic
1158392575 18:57055598-57055620 TGGACAGGTGTGTGGAAAGGTGG - Intergenic
1160047961 18:75405500-75405522 TGGAGGGTTGGGGGTAAAGGAGG + Intergenic
1160226803 18:77018264-77018286 TGGATGGATGAGTGGATAGATGG - Intronic
1160226872 18:77018600-77018622 TGGATGGATGAGTGGATAGATGG - Intronic
1160226901 18:77018736-77018758 TGGATGGATGAGTGGATAGATGG - Intronic
1160253096 18:77221309-77221331 TGGATGGGTGGATGGATAGGTGG - Intergenic
1160687170 19:442468-442490 TGGATGGGTGGGTGGATGGGTGG + Intronic
1160687242 19:442680-442702 TGGATGGGTGGGTGGACGGGTGG + Intronic
1160687289 19:442820-442842 TGGATGGGTGGGTGGATGGGTGG + Intronic
1160687454 19:443403-443425 TGGACGGGTGAGTGGATGGGTGG + Intronic
1160687507 19:443599-443621 TGGACGGGTGAGTGGATGGGTGG + Intronic
1160687537 19:443711-443733 TGGACGGGTGAGTGGATGGGTGG + Intronic
1160687637 19:444054-444076 TGGATGGGTGGGTGGATGGGTGG + Intronic
1160692129 19:465025-465047 TGGATGAGTGAGTGGATGGGTGG + Intronic
1160692139 19:465064-465086 TGGATGGGTGGGTGGAAGGATGG + Intronic
1160692258 19:465512-465534 TGGATGGGTGAGTGGATAGATGG + Intronic
1160692351 19:465857-465879 TGGATGGGTGGGTGGATGGGTGG + Intronic
1160692356 19:465869-465891 TGGATGGGTGGGTGGATGGGCGG + Intronic
1160692399 19:466027-466049 TGGATGGGTGGGTGGATGGGTGG + Intronic
1160692479 19:466335-466357 TGGATGGATGAGTGGATAGATGG + Intronic
1160767747 19:815933-815955 TGGATAGGTGAGTGAGACGGTGG - Intronic
1160767986 19:816940-816962 TGGATGGGTGGATGGATAGGTGG - Intronic
1160926668 19:1549896-1549918 TGGATGGGTGAGTGGGTGGGTGG - Intergenic
1160926794 19:1550326-1550348 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1161049747 19:2156912-2156934 TAGATGGGTGGGTGGATAGGTGG - Intronic
1161049753 19:2156928-2156950 TGGATGGGTGAATGGATAGATGG - Intronic
1161049856 19:2157509-2157531 TGGATGGGTTACTGTATGGGTGG - Intronic
1161090336 19:2357028-2357050 TGGATGGGTGTGTGGATAGATGG - Intergenic
1161090387 19:2357247-2357269 TGGATGGGTATGTGGATAGGTGG - Intergenic
1161090404 19:2357319-2357341 TGGATGGGTGTGTGGATGGGTGG - Intergenic
1161090502 19:2357740-2357762 TGGATGGATGAGTGGAGGGGTGG - Intergenic
1161090558 19:2357930-2357952 TGGGTGGGTGAGTAGACAGGTGG - Intergenic
1161105277 19:2440736-2440758 TGGATGGATGAGTGGATAGATGG - Intronic
1161131316 19:2590645-2590667 TGAATGGGTGAATGGATAGGTGG - Intronic
1161131372 19:2590853-2590875 TGGATGGGTGAATGGATGGGTGG - Intronic
1161227457 19:3153668-3153690 TGGATGGATGAGTGGATAGATGG + Intronic
1161227621 19:3154422-3154444 TGGATGAGTGAGTGGATAGATGG + Intronic
1161243419 19:3235603-3235625 TGGATGGGTGGATGAATAGGTGG + Intronic
1161287369 19:3475785-3475807 TGGATGAGTGAGTGTGTGGGTGG + Intronic
1161287733 19:3477524-3477546 TGGATGGGTGAGTGGGTAGATGG + Intronic
1161347738 19:3776571-3776593 TGGATGGATGGGTGGACAGGTGG + Intergenic
1161347774 19:3776709-3776731 TGGATGGATGAGTGGATAGTGGG + Intergenic
1161347784 19:3776763-3776785 TGGATGGATGAGTGGATAGTGGG + Intergenic
1161372919 19:3923757-3923779 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1161422817 19:4185033-4185055 TGGATGGATGAGTGGATGGGTGG + Intronic
1161489338 19:4553368-4553390 TGGATGGGTGAGTGGATGGATGG + Intronic
1161489355 19:4553437-4553459 TGGATGGGTGAGTGGATGGATGG + Intronic
1161498777 19:4601726-4601748 TGGATGGATGGGTAGAAAGGTGG + Intergenic
1161499028 19:4603146-4603168 TGGATGGGTGAGTGGATGGATGG + Intergenic
1161565449 19:4999665-4999687 TGGATGGGTGGGTGGATAGATGG - Intronic
1161565460 19:4999713-4999735 TGGGTGGGTGGGTGGACAGGTGG - Intronic
1161565530 19:4999981-5000003 TGGGTGGGTGGGTGGACAGGGGG - Intronic
1161565555 19:5000070-5000092 TGGGTGGGTGGGTGGACAGGTGG - Intronic
1161565580 19:5000166-5000188 TGGGTGGGTGGGTGGACAGGTGG - Intronic
1161641148 19:5424033-5424055 TGGATGGCTGAGTGGGAAGATGG - Intergenic
1161679650 19:5673519-5673541 TGGATGGGTGGGTGGGTAGGTGG - Intergenic
1161766154 19:6210036-6210058 TGGGTGGGTGAGTGGATGGGTGG - Intergenic
1161857938 19:6776448-6776470 TGGATGGGTGGGTGGATGGGTGG - Intronic
1161858052 19:6777076-6777098 TGGATGGGTGGGTGGGCAGGTGG - Intronic
1161868918 19:6855519-6855541 TAGATGCGTGAGTGGAAGGGTGG - Intronic
1161974181 19:7599706-7599728 TGGATGGATGAGTGTGTGGGTGG - Intronic
1161974235 19:7599875-7599897 TGGATGGATGGGTGGATAGGTGG - Intronic
1161974519 19:7600710-7600732 TGGATGGGTGGATGGAAGGGTGG - Intronic
1161974536 19:7600754-7600776 TGGGTGGGTGGGTGGAAGGGTGG - Intronic
1162085823 19:8248586-8248608 TGGATGGGTGAATGGGTAGGTGG + Intronic
1162085896 19:8248917-8248939 TAGATGGATGAGTGGATAGGTGG + Intronic
1162388907 19:10377731-10377753 TGGGTGGGTGGGTGGATAGGTGG + Intronic
1162388915 19:10377755-10377777 TGGATGGGTGGGTGAGTAGGTGG + Intronic
1162389017 19:10378059-10378081 TGGATGGGTGGGTGGATGGGTGG + Intronic
1162389032 19:10378107-10378129 TGGATGGGTGGGTGGATGGGTGG + Intronic
1163171644 19:15535597-15535619 TGGATGAATGAGTGGATAGGTGG - Intronic
1163350569 19:16774165-16774187 TGGATGGGAGAGTGGGAAGGTGG - Intronic
1163350675 19:16774696-16774718 TGGATGGGTGAGTGGATGGATGG - Intronic
1163534012 19:17866682-17866704 TGGATGGGTGGGTGGATAGATGG - Intergenic
1163675574 19:18653856-18653878 TGGATGGGTGCATGGATAGGTGG - Intronic
1163675598 19:18653939-18653961 TGGGTGGGTGGGTGGACAGGTGG - Intronic
1163675671 19:18654171-18654193 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1163717063 19:18878876-18878898 TGGACGGGTGACACTAAAGGAGG + Exonic
1163731849 19:18954179-18954201 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1163731986 19:18954691-18954713 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1163732067 19:18954983-18955005 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1164239627 19:23373179-23373201 TGCATCGGTGACTGTAAAGAAGG - Intronic
1164394209 19:27849914-27849936 TGGCTTGGGGAGTGTAAAGAAGG - Intergenic
1164634929 19:29785152-29785174 TGGATGGGTGAGTGATTAGATGG + Intergenic
1164670216 19:30068148-30068170 TGGATGGGTGGGTGGATAGACGG - Intergenic
1164701377 19:30287320-30287342 TGGATGGGTGGGTGGGTAGGTGG + Intronic
1165168168 19:33871830-33871852 TGGATGGGTGGGTGGGTAGGTGG - Intergenic
1165168271 19:33872365-33872387 TGGATGGGTGGGTGGGTAGGTGG - Intergenic
1165168372 19:33872722-33872744 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1165168395 19:33872790-33872812 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1165190292 19:34057340-34057362 TGGATGGATGAGTGGATGGGTGG + Intergenic
1165381669 19:35485966-35485988 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1165759035 19:38309912-38309934 TGGGTGGGTGAGTGGGAGGGTGG - Intronic
1165774928 19:38398912-38398934 GGGATGGGTGAGAGAAAAGCGGG + Intergenic
1165973720 19:39656273-39656295 TGTTTGTGTGAGTGTAAGGGGGG + Intronic
1166730979 19:45058933-45058955 TGGATGGATGAATGGAATGGAGG - Intronic
1166739101 19:45103468-45103490 GGGAGGGGTGGGTGTGAAGGTGG - Intronic
1167161310 19:47769041-47769063 TGGATGGATGAGTGGACAGATGG - Intergenic
1167230439 19:48279572-48279594 TGGGTGGGTGGGTGTAGAGGGGG + Intronic
1167387641 19:49173421-49173443 TGGATGGATGAATGAAAAGATGG - Intronic
1167598392 19:50439324-50439346 TGGGTGGGTCAGTGGAAGGGTGG - Intronic
1167601221 19:50455976-50455998 TGGATGGGTGGATGTTAAGATGG - Intronic
1167783043 19:51612940-51612962 TGGAAGGGCGAATGGAAAGGAGG - Intronic
1167849802 19:52192666-52192688 TGGATGGATGAATGAAAAGATGG - Intronic
1168296981 19:55382095-55382117 TGGATGGGTGAATGCATAGATGG - Intronic
1168326702 19:55542420-55542442 TGGATGGATGAGTGGATGGGTGG - Intronic
1168326870 19:55543045-55543067 TGGATGGATGAGTGGATGGGTGG - Intronic
1168326895 19:55543157-55543179 TGGATGGGTGGGTGGATGGGTGG - Intronic
1168326973 19:55543408-55543430 AGGATGGGTGAGTGGACAGATGG - Intronic
1168330906 19:55567942-55567964 TGGATGGGTGAATGGATAGATGG + Intergenic
1168414302 19:56159012-56159034 TGGATGGGTGGGTGCATGGGTGG - Intronic
925216628 2:2101720-2101742 TGGATGGGTGAGTGGATGGATGG - Intronic
925347844 2:3183193-3183215 TGGATGGGTGAGTGGATGGGTGG - Intergenic
925750047 2:7080446-7080468 TGGATAGGTGAATGTAAATCTGG + Intergenic
925800923 2:7599584-7599606 TGGATGGGAGACTGCAAAGATGG + Intergenic
925978362 2:9156694-9156716 TGGATGGGTGGATGGACAGGTGG + Intergenic
926050315 2:9740293-9740315 TGGATGGGTGGGTGGATGGGTGG - Intergenic
927446484 2:23166539-23166561 TGGATAGGTGAGTCAAAATGTGG - Intergenic
927582281 2:24262905-24262927 TGGATGTGGAAGTGTAAAAGAGG - Intronic
927848818 2:26486151-26486173 TGGATGGGTGGGTGGATGGGTGG + Intronic
929119877 2:38475917-38475939 TGCATGGATGAGTATAAAGATGG - Intergenic
930086669 2:47502636-47502658 TGGATGGATGAGTGGATGGGTGG + Intronic
930765905 2:55084891-55084913 TGGTTGGCTGAGTGTCAGGGGGG - Intronic
931051396 2:58418830-58418852 TGGATGGGTAAGTGGGTAGGTGG + Intergenic
931216736 2:60251938-60251960 TGGATGGGTGGGTGGATAGATGG + Intergenic
931758504 2:65395448-65395470 TGAATGGATGAGTGTGAGGGAGG - Intronic
931947507 2:67326690-67326712 GGGATGGGAGAGTGGAAAGGTGG - Intergenic
932327264 2:70871548-70871570 TGGATGGGGGTGGGAAAAGGAGG - Intergenic
932674343 2:73765540-73765562 TGGATGGGTGGGTGGATGGGAGG - Intronic
933479351 2:82835437-82835459 GGGTTGGGTGGGAGTAAAGGGGG + Intergenic
935364019 2:102270713-102270735 TGGGTGGGTGAATGGACAGGTGG + Intergenic
935686743 2:105690194-105690216 TGGATGGGTGGGTGGATGGGAGG + Intergenic
936257823 2:110932549-110932571 TGGATGGGGGAGTGGAATTGAGG + Intronic
937077635 2:119118409-119118431 TGGATGAGTCAGGGTAAAAGTGG + Intergenic
937234061 2:120419821-120419843 TGGATGGGTGGGTGGATGGGTGG - Intergenic
937977039 2:127588694-127588716 TGGATGGGTGAATGGATGGGTGG + Intronic
937977042 2:127588706-127588728 TGGATGGGTGGGTGGATAGATGG + Intronic
937977058 2:127588757-127588779 TGGATGGGTGAGTGGATGGATGG + Intronic
937977080 2:127588816-127588838 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977102 2:127588910-127588932 TGGATGGGTGAGTGGATGGACGG + Intronic
937977141 2:127589036-127589058 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977169 2:127589152-127589174 TGGATGGGTGAGTGGATGGACGG + Intronic
937977181 2:127589184-127589206 TGGATGGGTGAATGGATGGGTGG + Intronic
937977206 2:127589268-127589290 TGGATGGGTGGGTGGATGGGTGG + Intronic
937977223 2:127589328-127589350 TGGATGGGTGAGTGGATGGATGG + Intronic
938188615 2:129255029-129255051 TGGATGAGTGGGTGTCTAGGTGG - Intergenic
938250071 2:129807946-129807968 TTGCTGTGTCAGTGTAAAGGGGG - Intergenic
940102595 2:150058885-150058907 TTGAAGAGTGAGTGTACAGGAGG - Intergenic
942018046 2:171836912-171836934 TGTATGTGTGTGTGTAATGGAGG - Intronic
942927954 2:181456636-181456658 TGAGTGGGTGCGTGAAAAGGGGG + Intergenic
943103134 2:183510853-183510875 TGGGTGGGGGAGATTAAAGGAGG + Intergenic
943134625 2:183893952-183893974 AGAAAGGGTGTGTGTAAAGGGGG - Intergenic
943957784 2:194214893-194214915 TGGAAGGGTGAAAGGAAAGGAGG - Intergenic
945165600 2:206939661-206939683 ATGATAGGTGAGTGTAAAGTGGG + Exonic
945267271 2:207902840-207902862 TGGATGGGTGGGTGGATGGGTGG - Intronic
946169189 2:217884336-217884358 TGGATGGATGTGTGTAAGGATGG + Intronic
946361172 2:219220135-219220157 TGCAGGGGTAGGTGTAAAGGTGG + Exonic
946719777 2:222592284-222592306 TGGATGGGTGGCTGGAAAGAAGG - Intronic
947191487 2:227510531-227510553 TGGAGGGGTGAGTTGAGAGGGGG + Intronic
947358659 2:229323324-229323346 AGGATGGGTGGGAGTAAAGGTGG + Intergenic
947836046 2:233176438-233176460 TGGATGGATGGGTGGATAGGTGG + Intronic
947836052 2:233176458-233176480 TGGATGGATGGGTGGATAGGTGG + Intronic
947836112 2:233176777-233176799 TGGATGGATGAATGAATAGGTGG + Intronic
948137879 2:235650459-235650481 TGGATGGGTGAGTGGGCAGAGGG - Intronic
948375390 2:237517416-237517438 TGGGTGGGTGAGTGGATAGGTGG + Intronic
948658268 2:239490366-239490388 TGGATGGGTGGGTGGATGGGTGG - Intergenic
948815672 2:240509194-240509216 TGGGTGGGTGAGTGGATGGGTGG + Intronic
948818648 2:240527101-240527123 TGGATGGGTGGGTGGGAAGATGG + Intronic
1168848666 20:961801-961823 TAGGTGGGTGAGTGTGTAGGTGG - Intronic
1168848722 20:962016-962038 TGGATGGCTGAATGCACAGGTGG - Intronic
1168857557 20:1019537-1019559 AGGATGGGTGAATGGAAATGTGG - Intergenic
1168980104 20:1996758-1996780 TGTGTGTGTGTGTGTAAAGGAGG - Intergenic
1169614573 20:7425782-7425804 TAGAAGGGTGGTTGTAAAGGAGG - Intergenic
1169840333 20:9928813-9928835 GGGATAGGTGAGTGTTAAGGTGG + Intergenic
1170812299 20:19684050-19684072 TGGATGGGTGAATGGATGGGAGG + Intronic
1170921591 20:20684488-20684510 TGGATGGCTGAGGATAAAGGTGG - Intronic
1171195154 20:23191225-23191247 TGGATGGGTGGGTGGATAGATGG + Intergenic
1171399221 20:24860880-24860902 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1172196174 20:33093243-33093265 TGAATGGGTGGGTGGATAGGTGG - Intronic
1172196249 20:33093582-33093604 TGGGTGGGTGAGTGGATAGGTGG - Intronic
1172196274 20:33093685-33093707 TGGGTGAGTGAGTGGATAGGTGG - Intronic
1172530167 20:35625566-35625588 AGGATGGATGAGTTTTAAGGTGG - Intergenic
1172779859 20:37430103-37430125 TGGATAGGTGAGTGAGTAGGTGG - Intergenic
1172783408 20:37450603-37450625 TGGATGGGTGGATGGATAGGTGG - Intergenic
1172899075 20:38320928-38320950 TGGATGGGTAAGTGGATGGGAGG + Intronic
1172899133 20:38321122-38321144 TGGGTGGGTGGGTGTATTGGTGG + Intronic
1172947073 20:38697760-38697782 AGGGTGGGAGGGTGTAAAGGAGG + Intergenic
1173273721 20:41559859-41559881 TGCGTGTGTGTGTGTAAAGGTGG - Intronic
1173790912 20:45827285-45827307 TGGGTGGTGGAGTGCAAAGGAGG - Exonic
1173921200 20:46746736-46746758 TGGATGTGGGAGTGCAAAAGAGG - Intergenic
1173974860 20:47179417-47179439 TGGATGGATGGGTGGATAGGTGG + Intronic
1173974885 20:47179503-47179525 TGGATGGATGGGTGGATAGGTGG + Intronic
1173974901 20:47179563-47179585 TGGATGGATGAATGGAAGGGTGG + Intronic
1174198425 20:48789882-48789904 TGGATGGGTGATGGATAAGGAGG + Intronic
1174343475 20:49912846-49912868 TGGGTAGGTGAGGGAAAAGGCGG + Intronic
1174550513 20:51358209-51358231 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
1174550526 20:51358253-51358275 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
1174564530 20:51455781-51455803 TGGATGGATGAGTGGATGGGTGG + Intronic
1174564561 20:51455877-51455899 TGGATGGATGAGTGGATGGGTGG + Intronic
1174564585 20:51455941-51455963 TGGATGGATGAGTGGATGGGTGG + Intronic
1174564601 20:51455993-51456015 TGGATGGATGAGTGGATGGGTGG + Intronic
1174564627 20:51456069-51456091 TGGATGGATGGGTGGAAGGGTGG + Intronic
1175017959 20:55812138-55812160 TAGATGGGTGAATGGAAGGGTGG - Intergenic
1175313346 20:58027012-58027034 TGGATGGGTGAGTATATGGATGG - Intergenic
1175407389 20:58744019-58744041 TGGATGGGTGAGTGGATGGATGG + Intergenic
1175407480 20:58744396-58744418 TGGATGGATGAGTGGGTAGGTGG + Intergenic
1175407490 20:58744432-58744454 TGGATGGGTGAGTGGATGGATGG + Intergenic
1175526631 20:59638878-59638900 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1175633179 20:60559294-60559316 TGGGTGGGTGTGGGTGAAGGAGG - Intergenic
1175700191 20:61131324-61131346 AGGAGGGGTGAGTATGAAGGAGG - Intergenic
1175742431 20:61429552-61429574 TGGATGGGTGGATGGATAGGTGG + Intronic
1175742493 20:61429780-61429802 TGGATGGGTGGGTGGAAAGATGG + Intronic
1175772603 20:61633050-61633072 TGGATGGGTGAATGAAGAGATGG - Intronic
1175779278 20:61672058-61672080 TGGATGGATGAGTGGATTGGTGG + Intronic
1175817246 20:61889670-61889692 TGGATGAGTGAGTGGATAGTTGG + Intronic
1175817285 20:61889875-61889897 TGGATGGGTGAGTGAATGGATGG + Intronic
1175817311 20:61890021-61890043 TGGATGAGTGAGTGGATAGTTGG + Intronic
1175817348 20:61890215-61890237 TGGATGGGTGAGTGGATGGATGG + Intronic
1175817846 20:61892951-61892973 TGGATGGGTGGGTGAATAGAGGG + Intronic
1175817864 20:61893006-61893028 TGGATGGGTGGGTGGGAGGGTGG + Intronic
1175817889 20:61893113-61893135 TGGATGGGTGGGTGAATAGAGGG + Intronic
1175817971 20:61893433-61893455 TGGATGGGTGGGTGAATAGAGGG + Intronic
1175930525 20:62491841-62491863 TGGGTGGGTGAGGGTTCAGGGGG - Intergenic
1176199901 20:63855500-63855522 TGGATGCCTGAGAGTAGAGGAGG - Intergenic
1178694384 21:34780544-34780566 AGGAATAGTGAGTGTAAAGGCGG - Intergenic
1179025861 21:37677792-37677814 TGGATGGGTGGGTGGATAGGTGG - Intronic
1179256588 21:39721718-39721740 TGGATGGGTGGGTGGAAGGAAGG - Intergenic
1179474777 21:41636167-41636189 TGGATGGGTGAGTGGATGGATGG - Intergenic
1180043172 21:45290948-45290970 TTGGTGGGTGAGTGGAATGGCGG + Intergenic
1180085956 21:45508006-45508028 TGGATGGGTGGATGGAGAGGTGG + Intronic
1180085988 21:45508128-45508150 TGGGTGGGTGGATGGAAAGGTGG + Intronic
1180086070 21:45508452-45508474 TGGATGGGTGGATGGACAGGTGG + Intronic
1180213761 21:46311991-46312013 TGGATGGGTGGGTGGATGGGTGG - Intronic
1180902710 22:19386250-19386272 AGGAGGGGTGGGAGTAAAGGAGG - Intronic
1181732294 22:24855953-24855975 TGGATGGGTGAATGTAAAGATGG - Intronic
1181732299 22:24855977-24855999 TGGATGGGTGAATGTAAAGATGG - Intronic
1181750604 22:24986655-24986677 TGGATGGGTGGGTGGATGGGTGG - Intronic
1181750612 22:24986675-24986697 TGGATGGGTGGGTGGATGGGTGG - Intronic
1181765153 22:25086304-25086326 TGAGTGGGTGAGTGAAAAAGTGG + Intronic
1181822559 22:25487335-25487357 TGGATGGATGAGTGGAAAGGTGG + Intergenic
1181822589 22:25487451-25487473 TGGATGGGTGAGTGAATGGGTGG + Intergenic
1181822696 22:25487888-25487910 TGGAAAGGTGAGTGGAAGGGTGG + Intergenic
1181822734 22:25488059-25488081 TGGATGGATGGGTGAATAGGTGG + Intergenic
1181893487 22:26085381-26085403 TTGCCAGGTGAGTGTAAAGGAGG + Intergenic
1181900138 22:26147059-26147081 TGGATGGGTGAGTGGATGGATGG + Intergenic
1182009417 22:26987748-26987770 TGAATGGGTGAGTGGATGGGTGG + Intergenic
1182013285 22:27018414-27018436 TGGATGGATGAGTGGGTAGGTGG - Intergenic
1182048535 22:27295920-27295942 TGGATGGGTGAAAGGAAAGGAGG + Intergenic
1182060622 22:27394662-27394684 TAGATGGGTAAATGGAAAGGAGG + Intergenic
1183082196 22:35463608-35463630 TGGATGAGTGAATGGATAGGTGG - Intergenic
1183099962 22:35577969-35577991 TGGATGGGTGAGTGGGAAGTCGG + Intergenic
1183261789 22:36800083-36800105 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1183261795 22:36800111-36800133 TGGATGGGTGGGTGGATAGATGG - Intergenic
1183261838 22:36800257-36800279 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1183261844 22:36800285-36800307 TGGATGGGTGGGTGGATAGATGG - Intergenic
1183589795 22:38773439-38773461 TGGATGGGTGGGTGGATAGGTGG - Intronic
1183927911 22:41218973-41218995 TGGATGGCTGTGTGTAAACAAGG + Intronic
1184022312 22:41829010-41829032 TGGGTGTGTGAGTGTGAAGAGGG + Intergenic
1184123666 22:42471538-42471560 TGGATGGGTGAGTGGATGGATGG - Intergenic
1184123684 22:42471617-42471639 TGGGTGGGTAAGTGGATAGGTGG - Intergenic
1184414706 22:44345536-44345558 TGGGTGGGTGAGTGAATGGGTGG + Intergenic
1184444634 22:44540019-44540041 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1184460854 22:44637050-44637072 TGGATGGGTGATTGAACAGAGGG + Intergenic
1184609677 22:45594735-45594757 TGGATGGGTGAGTGGATAGATGG + Intronic
1184780816 22:46648470-46648492 TGGATGGGTGAGTGGATGGATGG + Intronic
1184787892 22:46680682-46680704 TGGATGGGTGGATGAATAGGTGG - Intergenic
1184787942 22:46680846-46680868 TGGGTGGGTGGGTGGAAAGATGG - Intergenic
1184991066 22:48170385-48170407 TGAATGGGTGAGTGAATGGGCGG - Intergenic
1185027226 22:48421854-48421876 TGGATGGGTGAATGGATTGGTGG + Intergenic
1185165539 22:49260178-49260200 TGGATGGATGGGTGGATAGGTGG - Intergenic
1185193496 22:49453456-49453478 TGGATGTGTGAGTGGAAGGATGG + Intronic
1185211429 22:49572892-49572914 TGGATGGGTGGGTGAATGGGTGG + Intronic
1185224580 22:49645237-49645259 TGGATGGGTGAATGGAATGATGG + Intronic
949449030 3:4165429-4165451 TGGGTGGGGGAGATTAAAGGAGG + Intronic
950025789 3:9819143-9819165 TGGAAGGATGAGTGGAAGGGTGG - Intronic
950116505 3:10453936-10453958 TGGATGGATGAGTGGATGGGTGG - Intronic
950145901 3:10649608-10649630 TGGATGGGTGAATGGACAGATGG + Intronic
950173452 3:10855014-10855036 TGGATGGGTGGGTGAGTAGGTGG + Intronic
950203013 3:11057910-11057932 TGGATGGGTGGATGGATAGGTGG + Intergenic
950328024 3:12131121-12131143 TGGATTGGTGAGTGGAATGTGGG - Intronic
950443785 3:13024580-13024602 TGGATGGGTGGGTGGATGGGTGG - Intronic
950474324 3:13206002-13206024 TGGATGGGTGGATGGAAAGATGG - Intergenic
950541266 3:13614686-13614708 TGGGTGGGTGAGTGAATGGGTGG - Intronic
950541827 3:13617659-13617681 TGGATGGGTGGGTGGATGGGTGG - Intronic
951466257 3:23003586-23003608 TGGATGGCTGAATGTAAAGAAGG - Intergenic
951869168 3:27341198-27341220 AGGGTGGGTGAGTGCAAGGGGGG + Intronic
952301474 3:32107486-32107508 TGTTTGGGTGAATGTAGAGGTGG + Intronic
952307663 3:32160284-32160306 TAGATGGGTGAGTGGATGGGTGG + Intronic
952307697 3:32160403-32160425 TGGATGGGTGAGTGGATGGGTGG + Intronic
952307727 3:32160509-32160531 TAGATGGGTGAGTGGATGGGTGG + Intronic
952307756 3:32160615-32160637 TAGATGGGTGAGTGGATGGGTGG + Intronic
952846068 3:37689031-37689053 TGGATGGGTGAGTGGATGGCTGG + Intronic
952960292 3:38585084-38585106 TGGTTGGGTGAGTGGACAGATGG + Intronic
953954450 3:47220538-47220560 TGGATGAGTGAGTGGAAGGGTGG - Intergenic
954541691 3:51397254-51397276 GGGGCGGGTGAGTGAAAAGGTGG + Exonic
954558994 3:51539621-51539643 TGGTTTGGGGAGTGTAGAGGAGG + Intergenic
954916273 3:54150902-54150924 TGGATGGGTGAATGGATGGGTGG + Intronic
954932507 3:54296307-54296329 TGGCTGGGAGAGAGAAAAGGAGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955537147 3:59935664-59935686 TGGATGGGTGAATGGATGGGTGG + Intronic
959365322 3:105451006-105451028 AGGAAGGGTGAGTGTAAAACAGG + Intronic
960959369 3:123058450-123058472 AGGATGGGTAGGTGGAAAGGAGG + Intergenic
961736378 3:129004383-129004405 TGGATGGGTGAGTGGATGGATGG - Intronic
961736388 3:129004427-129004449 TGGGTAGGTGAGTGGATAGGTGG - Intronic
961736401 3:129004487-129004509 TGGGTGGGTGAGTGGATGGGTGG - Intronic
961927794 3:130500823-130500845 TTGATGGGTGTGTGTAATAGAGG + Intergenic
962104722 3:132378924-132378946 TGGAAGTGTTAGTCTAAAGGAGG + Intergenic
962571647 3:136719600-136719622 TGGATGGGTGGGTGGGTAGGTGG + Intronic
963057678 3:141200741-141200763 TGGATGGGTAAGGGTATAGGTGG + Intergenic
963057691 3:141200817-141200839 TGGATGGATGAGTGTATAGATGG + Intergenic
964981193 3:162682700-162682722 TGAATGGATGAATGAAAAGGAGG - Intergenic
965726488 3:171721941-171721963 TAAATCGGTGTGTGTAAAGGTGG + Intronic
967739645 3:192990962-192990984 TGAAAGGCTGAGTGTGAAGGAGG + Intergenic
968405205 4:335022-335044 TGGATGGGTGGTTGAAAGGGTGG + Intergenic
968598638 4:1498529-1498551 TGGATGGGTGGATGGACAGGTGG + Intergenic
968598643 4:1498549-1498571 TGGGTGGGTGAGTGGATAGATGG + Intergenic
968733515 4:2283403-2283425 TGGATGGGTGGGTGGATGGGTGG - Intronic
968733524 4:2283427-2283449 TGGATGGATGAGTGGATGGGTGG - Intronic
968733529 4:2283447-2283469 TGGATGGGTGGGTGGATGGGTGG - Intronic
968928089 4:3560540-3560562 TGGATGGGTGGGTGGATGGGTGG - Intergenic
968928097 4:3560560-3560582 TGGATGGGTGGGTGTATGGATGG - Intergenic
968935916 4:3610304-3610326 TGGATGGATGAGTGGATGGGCGG - Intergenic
968946127 4:3665453-3665475 TGGATGGGTGGGTGTATGGATGG - Intergenic
968946143 4:3665509-3665531 TGGGTGGGTGAATGGATAGGTGG - Intergenic
968946187 4:3665661-3665683 TGGATGGATGAGTGGATGGGTGG - Intergenic
969110835 4:4843257-4843279 TGGATGGGTGGGTGGAGAGACGG + Intergenic
969216699 4:5728976-5728998 CAGATGGGTGAATGAAAAGGTGG - Intronic
969216719 4:5729080-5729102 TGGATGGGTGAATGAATGGGTGG - Intronic
969448972 4:7262278-7262300 TGGATGGGTGGGTGGATAGATGG - Intronic
969479248 4:7438797-7438819 TGGACAGGTGAGAGGAAAGGAGG - Intronic
969501662 4:7557011-7557033 TGGATGGATGAGTGGACAGATGG - Intronic
969510370 4:7614250-7614272 TGGATGGATGAGTGGATGGGTGG - Intronic
969510375 4:7614270-7614292 TGGATGGGTGAGTGGATGGGTGG - Intronic
969523169 4:7690591-7690613 TGGATGGGTGAGTGGATGGATGG + Intronic
969523173 4:7690607-7690629 TGGATGGATGAGTGGATGGGTGG + Intronic
969524025 4:7695229-7695251 TGGATGGATGAGTGGATGGGTGG + Intronic
969524042 4:7695293-7695315 TGGATGGGTGAGTGAATGGGTGG + Intronic
969524101 4:7695473-7695495 TGGATGGGTGAGTGGATGGGTGG + Intronic
969524108 4:7695493-7695515 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969524115 4:7695513-7695535 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969565402 4:7974427-7974449 TGGGTGGGTGGGTGGAAGGGTGG - Intronic
969565461 4:7974657-7974679 TGGATGGGTGGATGGATAGGTGG - Intronic
969624343 4:8294746-8294768 TGGATGGGTGGATGGAAAGATGG - Intronic
969687523 4:8683951-8683973 TGGATGGGTGGGTGAATGGGTGG + Intergenic
970686740 4:18577119-18577141 TGTGTGTGTGTGTGTAAAGGGGG + Intergenic
970885808 4:20986328-20986350 TGGATGGGTGATTGGGCAGGTGG - Intronic
971449489 4:26786790-26786812 TGGATGGGTGGGTGGAAGGATGG + Intergenic
972390654 4:38609928-38609950 TGCTTGTGTGAGAGTAAAGGAGG - Intergenic
974490483 4:62557871-62557893 TGGGAGGGTGAATGAAAAGGAGG - Intergenic
976099148 4:81541988-81542010 TGAATGGGTGGGTGGAAAGTTGG + Intronic
976200212 4:82570525-82570547 AGGATGGGTGAGTTTTGAGGAGG - Intergenic
976816176 4:89150098-89150120 TTGATTGGTGAGTGAAAAGCAGG + Intergenic
980051423 4:128043885-128043907 TGGAGGGCTGATTGAAAAGGAGG - Intergenic
985529756 5:426981-427003 TGGATGGGTGGATGTGAAGATGG + Intronic
985560553 5:584019-584041 TGGATGGGTGAGTGGATGGGTGG + Intergenic
985560585 5:584107-584129 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
985560719 5:584602-584624 TGGATGGGTGGGTGAATGGGTGG + Intergenic
985560751 5:584702-584724 TGGATGGGTGGGTGAATGGGTGG + Intergenic
985560799 5:584870-584892 TGGATGGATGGGTGGAAGGGTGG + Intergenic
985619982 5:949073-949095 GGGCTGGGTGAGTGAACAGGAGG + Intergenic
985662968 5:1166470-1166492 TGGGTGGGTGGGTGGATAGGTGG - Intergenic
985663016 5:1166669-1166691 TGGATGGATGAGTAGATAGGTGG - Intergenic
985703703 5:1388629-1388651 TGGATGGATGAATGAATAGGTGG - Intergenic
985821124 5:2160974-2160996 TGGATGGGTGAGTGTGTGGGTGG - Intergenic
985829746 5:2219590-2219612 TGGATGGGTGGGTGGAAGGATGG - Intergenic
985837374 5:2280995-2281017 TGGATGGGTGGGTGAATGGGTGG + Intergenic
985837426 5:2281210-2281232 TGGGTGGGTGAGTGGACAGGTGG + Intergenic
985874519 5:2585009-2585031 TGGATGGGTGAATGGATGGGTGG + Intergenic
985874544 5:2585129-2585151 TGGATGGATGAATGTATGGGTGG + Intergenic
985874621 5:2585473-2585495 TGAATGGGTGGGTGGATAGGTGG + Intergenic
985949435 5:3212164-3212186 TGGATGGGTGTGTGTGCATGTGG + Intergenic
986416836 5:7537483-7537505 TGGAGGGGTGAGTGTGATGGAGG - Intronic
987040555 5:14057940-14057962 TGGATGCCTAAGTGTAAAGTGGG + Intergenic
987051025 5:14146173-14146195 TGGATGGGTGGGTGTGGGGGTGG + Intronic
989813955 5:45712611-45712633 TGGAAGGGTGAGGGAGAAGGAGG + Intergenic
990741866 5:58920461-58920483 TGGATGGGTGGGTGGAAACTTGG + Intergenic
991462794 5:66877117-66877139 TGGATGGGTGATTGAGGAGGAGG + Intronic
995358928 5:111270985-111271007 AGGAAGGGAGAGTGTGAAGGAGG + Intronic
996876257 5:128243590-128243612 TGGATGGATGAGTGGATAGATGG + Intergenic
997439196 5:133897357-133897379 TGGATGGGTGAATGGATAGGTGG + Intergenic
997439202 5:133897377-133897399 TGGATGGGTGAATGGATGGGTGG + Intergenic
997734131 5:136201036-136201058 TGGATGGGTGAATTCAAGGGTGG - Intergenic
998164513 5:139835329-139835351 TGGATGGGGAAGTGGACAGGTGG - Intronic
998778513 5:145630159-145630181 TGGATGAGTGGGTGGATAGGTGG + Intronic
998875518 5:146595097-146595119 TGGAAGTGAGAGAGTAAAGGTGG - Intronic
999185662 5:149706522-149706544 TGGATGGATGAGTGGATAGATGG - Intergenic
1000182205 5:158822347-158822369 TGGATGGATGAGTGGAGAGGAGG + Intronic
1001029295 5:168250225-168250247 TGGATGGGTGTGTGGATGGGAGG + Intronic
1001329805 5:170754268-170754290 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1001329813 5:170754296-170754318 TGGATGGGTGGATGGATAGGTGG + Intergenic
1001329820 5:170754316-170754338 TGGATGGGTGAGTGGGTGGGTGG + Intergenic
1001329862 5:170754468-170754490 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1001329870 5:170754496-170754518 TGGATGGGTGGATGGATAGGTGG + Intergenic
1001329876 5:170754516-170754538 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1001329881 5:170754528-170754550 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1001329893 5:170754568-170754590 TGGATGGGTGAGTGGGTGGGTGG + Intergenic
1001413331 5:171526016-171526038 TGGATGGATGAATGGATAGGTGG - Intergenic
1001532588 5:172474335-172474357 TGGATGACTGAGTTAAAAGGTGG + Intergenic
1001567309 5:172707854-172707876 TGGGTGGGTGAGTGTCAGTGTGG + Intergenic
1001701730 5:173711699-173711721 TGGATGGGTGAGTAGACAGATGG + Intergenic
1001778522 5:174347490-174347512 TGGATGGATGGGTGTGTAGGTGG + Intergenic
1001828748 5:174767719-174767741 TGGATGGGTGAGTGGGTAGATGG - Intergenic
1001833681 5:174811578-174811600 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1001849518 5:174951571-174951593 TGGGTGGGTGCGTGGACAGGTGG - Intergenic
1001878934 5:175225980-175226002 TGGGTGGGTGAATGTATAGGTGG + Intergenic
1001900133 5:175420408-175420430 TGGATGGGTGAGTGTGTGGGTGG - Intergenic
1001900179 5:175420600-175420622 TGGATGGGTGGGTGTGTGGGTGG - Intergenic
1001900188 5:175420632-175420654 TGGATGGGTGTGTGTGTGGGTGG - Intergenic
1002067607 5:176659985-176660007 TGGATGGATGAGTGAATAGATGG - Intergenic
1002095726 5:176829596-176829618 TGGATGGGTGGGTGGATGGGTGG + Intronic
1002303268 5:178269463-178269485 TGGATGGGTGGGTGGATGGGTGG - Intronic
1002303273 5:178269475-178269497 TGGATGGGTGGGTGGATGGGTGG - Intronic
1002303284 5:178269503-178269525 TGGATGGGTGGGTGGATGGGTGG - Intronic
1002303319 5:178269630-178269652 TGGATTGGTGAGTGGATGGGTGG - Intronic
1002658978 5:180777591-180777613 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1002834844 6:857439-857461 TGGATGGATGGGTGGATAGGTGG - Intergenic
1002834884 6:857618-857640 TGGATGGATGGGTGGATAGGTGG - Intergenic
1002917924 6:1544056-1544078 TGGATGGGTGAATGGAAGGATGG + Intergenic
1002917945 6:1544156-1544178 TGGATGGATGAGTGGACTGGTGG + Intergenic
1002917976 6:1544264-1544286 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1002917993 6:1544332-1544354 TGGATGGATGAGTGGATGGGTGG + Intergenic
1003113326 6:3266495-3266517 CGTATGGGTGAGGCTAAAGGAGG + Intronic
1003285230 6:4728402-4728424 AGGATGGGGGAGTGAAGAGGAGG - Intronic
1003667975 6:8129231-8129253 TGGATGGGTGAGTGGGTGGGTGG - Intergenic
1005796402 6:29366524-29366546 TGGATGGGAGAGTGTGAAGTAGG + Intronic
1006287170 6:33105452-33105474 TGGGTGGGTGAGTGAATAGATGG + Intergenic
1006299839 6:33187852-33187874 TGGGTGGGTGAGTGAATAGCTGG + Intronic
1008702663 6:54119996-54120018 GGGATGGGTGAGAGTAGAGAAGG - Intronic
1012328893 6:97959527-97959549 TGGATGGCAGAGTATACAGGAGG + Intergenic
1013572757 6:111446309-111446331 TGGATTGTTGAGAATAAAGGTGG + Intronic
1015539777 6:134301922-134301944 TGGATGGATAAGTGTCAAGAAGG + Intronic
1016096849 6:140048464-140048486 TGGGAGGGAGAGTGGAAAGGAGG - Intergenic
1016446879 6:144142735-144142757 AGGTTGTGTGAGTGGAAAGGGGG + Intergenic
1016533557 6:145085818-145085840 TAGATAAGTGAGTGTAAATGTGG + Intergenic
1017821654 6:158053610-158053632 TGGATGGGTGGGTAGATAGGTGG - Intronic
1018230752 6:161673170-161673192 TGGATGAGTGTGTGTGAGGGTGG - Intronic
1018871864 6:167790072-167790094 TGGATGGTTGAGTGCAGGGGTGG - Intronic
1018871883 6:167790131-167790153 TGGATGGTTGAGTGCAGGGGTGG - Intronic
1019319313 7:408388-408410 TGGATGGGTGAATGGATAGATGG - Intergenic
1019489576 7:1305934-1305956 TGGATGGATGAGTGGATGGGTGG - Intergenic
1019489615 7:1306108-1306130 TGGATGGATGAGTGGATGGGTGG - Intergenic
1019489661 7:1306298-1306320 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1019510542 7:1415412-1415434 TGGATGGGTGGGTGGGTAGGTGG + Intergenic
1019510574 7:1415516-1415538 TGGATGGGTGGGTGGACAGATGG + Intergenic
1019510584 7:1415556-1415578 TGGATGGGTGGGTGAATAGATGG + Intergenic
1019510628 7:1415730-1415752 TTGATGGGTGGGTGGATAGGTGG + Intergenic
1019510743 7:1416131-1416153 TGGATGGGTGGATGGATAGGTGG + Intergenic
1019546194 7:1577912-1577934 TGGATGGATGAGTGGATGGGTGG - Intergenic
1019546367 7:1578624-1578646 TGGATGGGTGAGTGGATGGATGG - Intergenic
1019546390 7:1578792-1578814 TGGATGGGTGAGTGGATGGATGG - Intergenic
1019567294 7:1690640-1690662 TGAATGGGTGGGTGGAGAGGTGG + Intronic
1019617246 7:1970188-1970210 TGGCTGGGTGAATGGAAAGGGGG + Intronic
1019704042 7:2488970-2488992 TGCATGGGTCAGTGTCAGGGCGG + Intergenic
1019782559 7:2952389-2952411 GGGATGGGTGAGTGTGCTGGGGG + Intronic
1020460540 7:8425173-8425195 GGGATGGGAGAGAGGAAAGGAGG + Intergenic
1022516280 7:30976860-30976882 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1022764706 7:33398411-33398433 TGCTTGAGTGAATGTAAAGGTGG + Intronic
1024290338 7:47799189-47799211 TGGATGGGTGGGTGGATAGGTGG + Intronic
1026907575 7:74071306-74071328 TGGATGGGTGGGTGGATAGATGG - Intergenic
1028413524 7:90556688-90556710 TGGGTGGGTGAGTGGATAGATGG - Intronic
1029108374 7:98196483-98196505 TGGATGGGGTAATGTATAGGTGG + Intronic
1029116927 7:98242409-98242431 TGGATGGGTGGGTGGGTAGGTGG - Intronic
1029116956 7:98242534-98242556 TGGATGGATGGGTGTGTAGGTGG - Intronic
1029599720 7:101556608-101556630 TGGATGGATGAGTGGACAGGTGG + Intronic
1030083072 7:105793988-105794010 TGGATGGGTGGATGGATAGGTGG - Intronic
1030490470 7:110226827-110226849 GGGCTGGGTGAGACTAAAGGTGG - Intergenic
1032697234 7:134347852-134347874 TGGATGGATGGGTGGATAGGTGG + Intergenic
1034276766 7:149827260-149827282 TGGAGGGGTGAGCGGAAATGAGG + Intergenic
1034843619 7:154422659-154422681 TGGATGGGTGGGTGGATGGGTGG + Intronic
1035065544 7:156102417-156102439 TGGATGGATGAGTGGATGGGTGG + Intergenic
1035225567 7:157430394-157430416 TGGATGGATGGGTGGACAGGTGG - Intergenic
1035278955 7:157765477-157765499 TGGATGGGTGGGTGTGTGGGTGG - Intronic
1035278977 7:157765561-157765583 TGGATGGATGAGTGGATGGGTGG - Intronic
1035279032 7:157765795-157765817 TGGATGGGTGAGTGAATGGATGG - Intronic
1035288555 7:157822222-157822244 TGGATGGATGAGTGTATAGATGG - Intronic
1035290713 7:157837025-157837047 TGGGTGGGTGGGTGGACAGGTGG - Intronic
1035290758 7:157837175-157837197 TGGATGGGTGGGTGGATGGGTGG - Intronic
1035290782 7:157837257-157837279 TGGATGGGTGGGTGGATGGGTGG - Intronic
1035296317 7:157868689-157868711 TGGATGGGCGAGTGGGCAGGTGG - Intronic
1035520823 8:273947-273969 GTGGTGGGTGAGGGTAAAGGTGG + Intergenic
1035527402 8:324609-324631 TGAATGGGTGGGTGAACAGGGGG + Intergenic
1036255896 8:7206430-7206452 TGGATGGGTGGGTGGATAGATGG + Intergenic
1036361591 8:8081069-8081091 TGGATGGGTGGGTGGATAGATGG - Intergenic
1036889384 8:12585957-12585979 TGGATGGGTGGGTGGATAGATGG + Intergenic
1038325091 8:26567040-26567062 TGGATGGCTGAGTGGGTAGGTGG - Intronic
1038671124 8:29584096-29584118 TGGATGGGTGGGTGGAGATGAGG + Intergenic
1038712670 8:29962504-29962526 TGGATAGGTGGGTAAAAAGGAGG + Intergenic
1039110994 8:34040769-34040791 TGGATGGGTGAGTGGGTGGGTGG - Intergenic
1039846643 8:41330262-41330284 TGGATGGGTAAGTGGATAGATGG + Intergenic
1039922534 8:41903515-41903537 TGGGTGGGAGAGTGCAGAGGAGG - Intergenic
1040539802 8:48342364-48342386 TGGATGGGTGAGACAAAAGTAGG - Intergenic
1041060662 8:54031669-54031691 TGGATTGGTGTGTGTAGGGGTGG + Intergenic
1041874104 8:62667842-62667864 TGGGTGGATGATTGTAAAAGAGG - Intronic
1042522383 8:69727212-69727234 TGGGTGGGTGAGTGGATAGATGG + Intronic
1042909488 8:73811129-73811151 TGGATGTGTAAGTTTAGAGGAGG - Intronic
1042964300 8:74334466-74334488 TGGATGGGTGAGTGGGTAGGTGG - Intronic
1043935480 8:86137483-86137505 AGGAGGGGTTAGTTTAAAGGTGG - Intronic
1044553370 8:93536213-93536235 TGGAGGGTGGAGTGCAAAGGAGG - Intergenic
1044777076 8:95701153-95701175 TGGATGGGCAAGAGTAAAAGAGG - Intergenic
1046801419 8:118432728-118432750 TGAATGGGTGGGTGTCAAGAAGG + Intronic
1047215943 8:122876095-122876117 TGGATGGATGAGTGAGTAGGTGG - Intronic
1047657362 8:126992455-126992477 TGGGTGGGTGAGTGAATGGGTGG + Intergenic
1048184404 8:132226396-132226418 TGCATGGGTGTGTGTAAGTGTGG + Intronic
1048570782 8:135653984-135654006 TGGGTGTGTGGGGGTAAAGGTGG - Intronic
1048979754 8:139696966-139696988 TGGATGGGTGGGTGGGTAGGTGG + Intronic
1048979815 8:139697220-139697242 TGGATGGGTGAGTGGGTAGGTGG + Intronic
1049008578 8:139872805-139872827 TGGATGGGTGGGTGGATGGGTGG + Intronic
1049258506 8:141626373-141626395 TGGATGGGTGGGTGGATGGGAGG + Intergenic
1049287371 8:141783132-141783154 TGGATGGGTGGGTGAACAGGTGG - Intergenic
1049287392 8:141783208-141783230 TGGGTGGGTGAGTGAACAGGTGG - Intergenic
1049323162 8:142008064-142008086 TGGCTGGGTGTGTGTGATGGGGG - Intergenic
1049375025 8:142285309-142285331 TGGATGGGTAGGTGGATAGGTGG + Intronic
1049464946 8:142746831-142746853 TGGATGGGTGAGTGGATGGATGG + Intergenic
1049477167 8:142802110-142802132 TGGATGGGTGAATGGATGGGTGG + Intergenic
1049582346 8:143418385-143418407 TGGATGAGTGAGTGGATGGGTGG - Intergenic
1051337111 9:16076067-16076089 TGGATGAGTGGGTGTAGAGGAGG + Intergenic
1052761763 9:32599673-32599695 TGGGGGGGTGAGTGCTAAGGAGG + Intergenic
1053802956 9:41775641-41775663 TGGATGGGTGGGTGTATATATGG - Intergenic
1053802961 9:41775661-41775683 TGGATGGGTGGGTGTATGGATGG - Intergenic
1054142305 9:61539465-61539487 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1054462050 9:65470615-65470637 TGGATGGGTGGGTGGATGGGTGG + Intergenic
1054771718 9:69089796-69089818 TGGATGGGTCAGGGTGGAGGTGG + Intronic
1055295030 9:74825482-74825504 TGTATGTGTGTGTGTATAGGTGG + Intronic
1055641197 9:78320213-78320235 TGGATGGGTGAATGAATGGGCGG - Intronic
1055664775 9:78542402-78542424 TGGATGGGTGTGCGAAAAGAGGG + Intergenic
1056682317 9:88730511-88730533 TGGATGGATGAATGAACAGGTGG - Intergenic
1056682357 9:88730709-88730731 TGGATGGATGAATGGACAGGTGG - Intergenic
1056682420 9:88730997-88731019 TGGATGGATGAATGGACAGGTGG - Intergenic
1057696741 9:97328560-97328582 TGGATGAGGGAGAGTCAAGGTGG - Intronic
1057828987 9:98392941-98392963 TGGGTGGGTGAGTGGATAGATGG - Intronic
1057829003 9:98392998-98393020 TGGATGGGTGTGTGAATGGGCGG - Intronic
1057829060 9:98393255-98393277 TGGGTGGGTGAGTGGATAGATGG - Intronic
1057972976 9:99575131-99575153 ATGATGGGTAAGTGTGAAGGTGG + Intergenic
1059498541 9:114730922-114730944 TGGATGGGCGGGTGAAAAGATGG - Intergenic
1059498603 9:114731156-114731178 TGGATAGGTGGGTGGATAGGTGG - Intergenic
1060889126 9:127177177-127177199 TGGATGGGTGAGTGGGTGGGTGG + Intronic
1060943585 9:127557260-127557282 TGGAAGGGTCAGTCTGAAGGAGG + Intronic
1061256615 9:129457203-129457225 TGGATGGGTGAGTGGATGGATGG + Intergenic
1061387583 9:130299615-130299637 TGGATGGGTGAGTGGATGGGTGG - Intronic
1061387603 9:130299711-130299733 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061387615 9:130299747-130299769 TGGATAGGTGAGTGAATGGGTGG - Intronic
1061387633 9:130299843-130299865 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061387640 9:130299867-130299889 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061387682 9:130300063-130300085 TGGATGGGTGAGTGGATAGATGG - Intronic
1061387721 9:130300270-130300292 TGGATGTGTGGGTGGACAGGTGG - Intronic
1061398698 9:130356967-130356989 TGGATGGATGGATGGAAAGGTGG + Intronic
1061398726 9:130357083-130357105 TGGATGGATGGATGGAAAGGTGG + Intronic
1061399491 9:130360681-130360703 TGGATGGATGAGTGGACAGGTGG - Intronic
1061399536 9:130360841-130360863 TGGATGGATGGGTGGATAGGTGG - Intronic
1061507728 9:131040982-131041004 TGGATGGGTGAATGAATGGGTGG + Intronic
1061716192 9:132519893-132519915 TGGATGGGTGGGTGGATGGGAGG + Intronic
1061846769 9:133392644-133392666 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1061846801 9:133392764-133392786 TGGATGGGTGGGTGGGCAGGTGG + Intronic
1061846826 9:133392848-133392870 TGGATGGGTGGGTGGGCAGGTGG + Intronic
1061964008 9:134003197-134003219 TGGATGGGTGGGTGGATGGGTGG - Intergenic
1062051919 9:134451886-134451908 TGGATGGGTGAATGGATGGGTGG - Intergenic
1062092310 9:134684897-134684919 TGGATGGGTGAATGGATAGATGG - Intronic
1062112306 9:134788785-134788807 TGGATGGGTGGGTAGACAGGTGG + Intronic
1062119491 9:134826658-134826680 TGGATGGGTGTGTGTATGGGTGG + Intronic
1062172269 9:135141559-135141581 TGGATGGATGAGTGGACAGATGG + Intergenic
1062217100 9:135395070-135395092 TGGATGGGTGGATGGAAGGGTGG + Intergenic
1062247710 9:135577997-135578019 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1062281331 9:135753142-135753164 TGGATGAGTGAGTGGAAAGATGG + Intronic
1062665399 9:137668399-137668421 TGGATGGGTGGGTGGTGAGGTGG - Intronic
1185495160 X:549220-549242 TGGATGGATGAGTGGGTAGGTGG - Intergenic
1185495334 X:550171-550193 TGGATGGATGAGTGGGTAGGTGG - Intergenic
1185495461 X:550955-550977 TGGATGGATGAGTGGATAGACGG - Intergenic
1185580863 X:1210831-1210853 TGGACAGGTGGGTGTATAGGTGG + Intronic
1185583182 X:1226550-1226572 TGGATGGGTGGGTGCATGGGTGG + Intergenic
1185583264 X:1226934-1226956 AGGATGGGTGAGTGGATGGGTGG + Intergenic
1185583305 X:1227118-1227140 AGGATGGGTGAGTGGATGGGTGG + Intergenic
1185613330 X:1405094-1405116 TGGATGGATGAGTGAACAGATGG + Intronic
1185624779 X:1474004-1474026 TGGATGGGTGGGTGGATGGGAGG + Intronic
1185624816 X:1474155-1474177 TGGATGGGTGGGTGTATGGATGG + Intronic
1185624828 X:1474199-1474221 TGGATGGGTGGGTGGATGGGAGG + Intronic
1185624870 X:1474388-1474410 TGGATGGATCAGTGTTTAGGTGG + Intronic
1185624920 X:1474625-1474647 TGGATGGATCAGTGTTTAGGTGG + Intronic
1185625028 X:1475128-1475150 TGGATGGATCAGTGTTTAGGTGG + Intronic
1185632592 X:1525959-1525981 TGAATGGGTGAGTGAATAGTGGG - Intronic
1185632638 X:1526381-1526403 TGAATGGGTGAGTGAATAGTGGG - Intronic
1185638962 X:1575824-1575846 TGGATGGGTAAGTAGAAAGTGGG + Intergenic
1185639252 X:1577618-1577640 TGGATGGGTGACTGTATGGATGG + Intergenic
1185639267 X:1577697-1577719 TGGATGGATGAGTGAATAGATGG + Intergenic
1185711015 X:2303806-2303828 TGGATGGGTGGGTGGATGGGTGG + Intronic
1185750441 X:2606852-2606874 TGGATGGATGAGTGAATAGATGG - Intergenic
1185755493 X:2650107-2650129 TGGATGTGTAGGTGGAAAGGTGG + Intergenic
1185755512 X:2650214-2650236 GGGATGGGTGAGTGGTATGGTGG + Intergenic
1185883068 X:3758375-3758397 TGGATGGGTGGGTGGATAGATGG - Intergenic
1185883271 X:3759256-3759278 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1185883297 X:3759383-3759405 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1186804851 X:13130218-13130240 TGCATGTGTGTGTGTAAAAGAGG - Intergenic
1186974196 X:14882334-14882356 TGGAGGGGTGAGGGTTGAGGCGG + Intronic
1187183239 X:16963457-16963479 TGGTTGGGTGAATGTATAGCAGG + Intronic
1188786096 X:34348484-34348506 TGGATGGGTGAGTGGAAAGATGG - Intergenic
1189268456 X:39733966-39733988 TGGATGGATGAGTGGATGGGAGG + Intergenic
1189589982 X:42500504-42500526 TGGATGGGTAAGTGTGGAAGGGG - Intergenic
1189605699 X:42675426-42675448 TGGGTGAGTGTGTGTAAATGTGG + Intergenic
1190599059 X:52070895-52070917 GGGATGTGTGAGTGTATGGGAGG - Intergenic
1190609765 X:52183178-52183200 GGGATGTGTGAGTGTATGGGAGG + Intergenic
1191910384 X:66143653-66143675 TGGCTGGTGGAGTGTACAGGAGG + Intergenic
1192436382 X:71145918-71145940 TGGGTGGGTGTGTGTATTGGGGG - Intronic
1194240676 X:91443518-91443540 TGGATGGATGAATGTGAGGGTGG + Intergenic
1194347106 X:92779330-92779352 TGGAGGGTTGAGGGTGAAGGTGG + Intergenic
1195563908 X:106319674-106319696 TGGATAGGTAAATGTAAAGACGG + Intergenic
1195786873 X:108534580-108534602 GGGAAGGGTAAGTGTCAAGGAGG + Intronic
1198105121 X:133454731-133454753 TGAATGAGTAGGTGTAAAGGTGG + Intergenic
1198488622 X:137114842-137114864 TGTGTGTGTGTGTGTAAAGGTGG - Intergenic
1199341223 X:146679530-146679552 TGAATGGCAGAGTCTAAAGGTGG - Intergenic
1199395324 X:147330611-147330633 TGGAGGGGTCAGTGGAAGGGGGG - Intergenic
1200655432 Y:5895968-5895990 TGGAGGGTTGAGGGTGAAGGTGG + Intergenic
1201305916 Y:12550421-12550443 TGGATGGGGGAGTGAGAAGAAGG + Intergenic