ID: 1102930616

View in Genome Browser
Species Human (GRCh38)
Location 12:116859387-116859409
Sequence GCCCCTCCCCAGAAAATGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102930609_1102930616 27 Left 1102930609 12:116859337-116859359 CCTTAAAGAAGCAGAGAACTGTG 0: 1
1: 0
2: 2
3: 24
4: 295
Right 1102930616 12:116859387-116859409 GCCCCTCCCCAGAAAATGGGGGG 0: 1
1: 0
2: 2
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102930616 Original CRISPR GCCCCTCCCCAGAAAATGGG GGG Exonic
900188705 1:1344454-1344476 GCCTCTTCCCAGCAAGTGGGTGG - Intronic
901397455 1:8991791-8991813 GTCCCACCCCAGAATGTGGGGGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
903069968 1:20722234-20722256 TCCCATCCCTAGAAACTGGGGGG + Intronic
903341429 1:22657149-22657171 TCCCCTCCCCAGAGGTTGGGGGG + Intronic
906507379 1:46390317-46390339 GCCCCTCTCCAAGCAATGGGAGG - Intergenic
907809065 1:57850596-57850618 GCCACTCCACAGGACATGGGAGG - Intronic
910727165 1:90351240-90351262 GCCCCTACCTATAAAATGAGGGG - Intergenic
912433657 1:109643521-109643543 GACTCTCCCCAGAAATCGGGCGG + Intergenic
916359269 1:163949817-163949839 GCCCCTCCCCAGAGACTAGGAGG - Intergenic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
920062363 1:203236266-203236288 TCCCCTTCCCAGAGGATGGGGGG - Intronic
921386059 1:214571068-214571090 CCCCCTTACCAGATAATGGGAGG + Intergenic
922759959 1:228122352-228122374 TCCCCTCCCCAGACATGGGGAGG + Intergenic
923421125 1:233816272-233816294 ACCCCACCCCAGACAATTGGTGG + Intergenic
1063156567 10:3384782-3384804 GGCCCTCCCCAGGACTTGGGAGG + Intergenic
1068981197 10:63063840-63063862 GCCCCTCCCCAAAAAACTAGAGG - Intergenic
1071078601 10:81783690-81783712 TCCCCTCCCCTGAGATTGGGAGG + Intergenic
1071860365 10:89666275-89666297 TCTCCTCCACAGAAAAAGGGAGG - Intergenic
1072468369 10:95688839-95688861 TCCCCTGCCCAGAAGATGGCAGG + Intronic
1073105961 10:101032185-101032207 CCCCCTCCCCAGCCAAAGGGAGG - Intronic
1074900250 10:117810427-117810449 GCCTCTCCCCACAAGATGCGAGG + Intergenic
1075212144 10:120500451-120500473 GCCACTACCCAGTCAATGGGTGG + Intronic
1075641791 10:124069982-124070004 GCATGTCCCCAGGAAATGGGCGG - Intronic
1076568558 10:131415750-131415772 GCCCTTCCCCAGAACCCGGGGGG + Intergenic
1077369776 11:2176036-2176058 GCTCCTCCCCAGCACATGGCTGG - Intergenic
1077556868 11:3230221-3230243 GCCTCTCCCCAGAGACTGGCTGG + Intronic
1083327014 11:61878056-61878078 GCCCCGCCCCAGGAAGTGGCTGG + Intronic
1084428273 11:69097397-69097419 GCCCCTCACCTGGCAATGGGAGG - Intergenic
1084535314 11:69752999-69753021 CCCCCTCCCCAGGTAATTGGGGG + Intergenic
1084663298 11:70559843-70559865 GCAACCCCCCAGAATATGGGTGG - Intronic
1087673376 11:101130798-101130820 GCCCCTCCCCAGATGATCGAGGG - Intergenic
1089463814 11:118670123-118670145 TCCCCTACCCAGAGATTGGGAGG + Intronic
1089776454 11:120840219-120840241 GCCCCTCTCCAGAACAGAGGAGG + Intronic
1091556682 12:1579027-1579049 CCCCCTCCCCAGATAATGACAGG - Intronic
1092810719 12:12268810-12268832 GCCCCTCCCCAGACATTGGAAGG - Intergenic
1096978844 12:55716921-55716943 CCCTCTCCCCAGAAAAGAGGAGG + Exonic
1097393517 12:59044858-59044880 GCCCCTCCCCCGAATATTGGTGG - Intergenic
1098203852 12:68085052-68085074 GCTCCTCCCCACAACATGTGGGG + Intergenic
1101513970 12:105417690-105417712 ACCCCTGCCTAGAAAAGGGGTGG - Intergenic
1102930616 12:116859387-116859409 GCCCCTCCCCAGAAAATGGGGGG + Exonic
1103549338 12:121725343-121725365 GACCCTCACCCAAAAATGGGAGG - Intronic
1104597935 12:130132657-130132679 CCTCCTTCCCAGAACATGGGTGG + Intergenic
1108266087 13:48710292-48710314 TGCCCTGCCCAGAACATGGGTGG - Exonic
1111812387 13:93107352-93107374 TCTCCTCCCCAGAAATTGAGGGG - Intergenic
1111946996 13:94676578-94676600 GCTCTTCCCCAGCAAGTGGGAGG + Intergenic
1113120059 13:106916462-106916484 GCCCCGCCCCAAAAAAAGGCAGG + Intergenic
1117483037 14:56168263-56168285 GCCCCCCCCCAGACCCTGGGTGG + Intronic
1118607128 14:67512721-67512743 GACCCTCCTCAGAAACTGGAAGG + Intronic
1119002236 14:70893076-70893098 GCCACTCCCCAGAAATTTGGAGG + Intergenic
1119618612 14:76114899-76114921 GCCCCTCCTGAGAAATTGTGGGG + Intergenic
1121334358 14:93068431-93068453 GCCACTGCCCAGGATATGGGTGG + Intronic
1122804619 14:104250232-104250254 GTCCCTCCACACCAAATGGGGGG - Intergenic
1122872101 14:104643479-104643501 GCCCCTCCCCAGGACAGGGAAGG + Intergenic
1124651827 15:31479687-31479709 ACCCCTCCCCAGAGACAGGGCGG + Exonic
1126437077 15:48646599-48646621 GCCTCTCCCCAGGATATGCGCGG + Intergenic
1128012367 15:64310106-64310128 GTCTCTCCCCAAAAAAGGGGTGG + Intronic
1128580638 15:68807411-68807433 CCACCTCCACAGAAAACGGGGGG + Intronic
1129120906 15:73395970-73395992 GCCTCTCCCCAGAATTTGAGAGG + Intergenic
1135381705 16:22001176-22001198 GCCACTGCCCAGAAATTGGGCGG + Intergenic
1137524177 16:49219399-49219421 ACCCCTCCCCACAACATGTGTGG + Intergenic
1138641399 16:58390916-58390938 GCCATTCCATAGAAAATGGGAGG - Intronic
1141910129 16:87053159-87053181 GCCCCTGCACAAAGAATGGGCGG + Intergenic
1142034566 16:87855283-87855305 GCCCCACCCCAGAGATGGGGAGG - Intronic
1142147782 16:88499751-88499773 GCCCCTCCCCAGCATGGGGGTGG - Intronic
1143347096 17:6257786-6257808 GCCCTTCCCCAGAAAATTCTGGG - Intergenic
1144106590 17:11991806-11991828 TCCCCTCCTCAGAAGCTGGGTGG - Intronic
1144145042 17:12389279-12389301 ACCCCTCCCCAGATACTGTGAGG + Intergenic
1145746577 17:27324574-27324596 GGACCTCACCAGAAAATGAGGGG + Intergenic
1146538794 17:33676831-33676853 GCCCCACCCCCAACAATGGGAGG - Intronic
1146946541 17:36877495-36877517 GCCCCTCCCCAGTGGGTGGGAGG - Intergenic
1147259433 17:39200275-39200297 TCCCCTTCGCAGATAATGGGAGG + Exonic
1148131897 17:45267154-45267176 GCTCCTCCAGAGAAAATGGCTGG + Exonic
1151420385 17:73993243-73993265 CCCCCACCACAGAGAATGGGTGG + Intergenic
1152281021 17:79384945-79384967 GCCTCTCCCCAGATAATGCTGGG - Intronic
1152533960 17:80939853-80939875 ACGCCTCCCCAGGGAATGGGGGG - Intronic
1156380854 18:36559807-36559829 GCCCCTTCCCAGACCTTGGGAGG - Intronic
1158109765 18:53928455-53928477 GCCTCTCCCCACAAAATGACAGG + Intergenic
1159042899 18:63342251-63342273 GCCCTTTCTCAGAAAATTGGTGG + Intronic
1159055518 18:63459494-63459516 GTCCCTCCCCACAACATGTGGGG + Intergenic
1160228472 18:77028951-77028973 GCTCCATCCCAGACAATGGGCGG + Intronic
1163698117 19:18774201-18774223 GCCCCTCCCCAAGAGATGGTGGG - Intronic
1164371824 19:27650131-27650153 GCCCCTTCCATGAAAATGGCTGG + Intergenic
1167172717 19:47843877-47843899 GCCCCTCCCGAAAAAACAGGGGG + Intergenic
928042624 2:27893474-27893496 CCCCCTCCCCAGAATTTGGTAGG - Intronic
928389563 2:30898744-30898766 ACCCCTCCCCAGCAACTGAGTGG - Intergenic
930774566 2:55159358-55159380 GCCCCTCCCCACAACAAGGTCGG + Intergenic
931095975 2:58941825-58941847 GCCCCTCCCCCCAACATGTGGGG - Intergenic
931193354 2:60026937-60026959 GCACCTCCCCAGAAATTTTGCGG - Intergenic
932214955 2:69960675-69960697 ACCCCTCCTCAGAAGAAGGGCGG - Exonic
934179383 2:89606761-89606783 GCCTCTACCCAGAAGATGGCAGG + Intergenic
934289673 2:91681024-91681046 GCCTCTACCCAGAAGATGGCAGG + Intergenic
940385983 2:153072327-153072349 GCCTCTCCCAAGAAAAAGGAGGG + Intergenic
942794170 2:179796559-179796581 TCCCTTCCCCACAAGATGGGGGG - Intronic
943564067 2:189496769-189496791 GCCCCTCTCCAGAAGGTGGAAGG - Intergenic
945818858 2:214638506-214638528 CCCCCTCCCCAGGGAGTGGGGGG - Intergenic
946172877 2:217905807-217905829 TCCCCTCTCCCCAAAATGGGAGG + Intronic
946776062 2:223142393-223142415 GCCCCTTCCCAGAAGAAGGACGG - Intronic
947568060 2:231208421-231208443 TACCCTCCCCAGGAAATGTGTGG + Intronic
947715482 2:232336908-232336930 TCCTCTGCCCAGGAAATGGGGGG + Exonic
948921812 2:241069407-241069429 CCCCCTCCCCAGTGCATGGGAGG + Intronic
1169206714 20:3744890-3744912 GTGCCTCCGCAGGAAATGGGAGG + Exonic
1169469756 20:5874013-5874035 TCCCCTTCCCAGAGAATGGGAGG - Intergenic
1175519239 20:59589006-59589028 GCCCATCCCCAGGAACAGGGAGG + Intronic
1175800068 20:61796474-61796496 GCCCCTTTCCAGGAAATGGGAGG - Intronic
1177207547 21:18027911-18027933 GTCCCTCCCCAGAAACTGGATGG + Intronic
1179802464 21:43817349-43817371 GCTCCGCCCCAGAAACCGGGTGG + Intergenic
1180130800 21:45825731-45825753 TCCCCTCCCCAGACAAAGTGAGG - Intronic
1182214949 22:28708173-28708195 ACCCCACCCCAGAAAATTGGAGG + Intronic
1182367786 22:29790413-29790435 GGCCCTCCCCAGATGGTGGGAGG + Intronic
1182448294 22:30402680-30402702 GCTCCTGCCCAGGAAATGTGAGG - Intronic
1183089194 22:35509747-35509769 GCCTCCTCCCAGAAAATCGGCGG + Intergenic
953507240 3:43498306-43498328 ATGCCTCCCCAGAAGATGGGTGG + Intronic
953902163 3:46849556-46849578 GCCCATCCCTAGAAAATAGCAGG + Intergenic
954978046 3:54715493-54715515 TCCCCTCCCCAGAATATGGGGGG + Intronic
956877212 3:73475616-73475638 ATCCATCCCCAGAAAATCGGGGG + Intronic
962249234 3:133825031-133825053 GCCTCTCCCCAAAGAATGTGAGG - Exonic
964336682 3:155662035-155662057 GCCCCTAACCAGAATATGGAAGG - Intronic
966733226 3:183167965-183167987 CCCCCTCCCCACAATATGTGGGG + Intergenic
967825918 3:193877288-193877310 GCCCCTGAGCAGAAAGTGGGAGG + Intergenic
968519178 4:1028035-1028057 GCCCCTCCCCAGGGAGTGGGCGG + Intergenic
968979498 4:3839089-3839111 AACCCTCCCCAGAACAAGGGAGG - Intergenic
969294696 4:6263040-6263062 GCCCCTCCCCAGAATAACAGTGG + Intergenic
972218696 4:36927212-36927234 TCACCTCCCCAGAAAATGGAAGG + Intergenic
976285033 4:83363090-83363112 GCCCAACCGCAGAGAATGGGAGG - Intergenic
977345383 4:95810691-95810713 CCCCCTCCCCTGAAAATGTATGG - Intergenic
980817937 4:137972938-137972960 GCACCTCCCAAAAAAATGGAGGG + Intergenic
983490628 4:168385182-168385204 TCCCTTCCCCAGAAATTGCGAGG - Intronic
988527902 5:32002414-32002436 GCCCCTCGCCGGAAATGGGGCGG + Intronic
989126176 5:38054411-38054433 TCCCCTCCCCAGAGGATGGGGGG - Intergenic
990314490 5:54571237-54571259 TCCCCTCCCGAGAGACTGGGAGG - Intergenic
991181482 5:63756391-63756413 GCCCTTCCCTACAAAATGAGGGG - Intergenic
994814899 5:104573188-104573210 GCCCCTCACCAGGAAATGTGTGG + Intergenic
997509018 5:134440677-134440699 GCCCATCACCATAACATGGGAGG - Intergenic
998169622 5:139864865-139864887 GCCCGACCCCAGAAGTTGGGAGG + Intronic
998618799 5:143771771-143771793 GCCTCTCCCCAGAGCATGAGTGG - Intergenic
998774097 5:145579717-145579739 ACCCCTCCTCAGACAAAGGGGGG - Intronic
1001995877 5:176157689-176157711 TCCTCTCCCCAGAGATTGGGAGG + Intergenic
1003507104 6:6749158-6749180 GCCTCTCCTCAGAATAAGGGAGG + Intergenic
1004142757 6:13035362-13035384 ACCCCTACCTAAAAAATGGGAGG - Intronic
1005078260 6:21930033-21930055 GCCCCTCCCTCGACATTGGGTGG + Intergenic
1006342029 6:33452366-33452388 TCCCCTCCCCATAACAAGGGGGG - Exonic
1007218512 6:40260290-40260312 GACCCTCCCCAGAAGCTGGAAGG - Intergenic
1007228230 6:40329495-40329517 GCTCCTCCCCAGAGAAAAGGAGG - Intergenic
1007674900 6:43585387-43585409 TCCCCTCCCCAGAAGTTGAGGGG + Intronic
1009290074 6:61870032-61870054 TTCCCTCCCCAGGAAAGGGGTGG + Intronic
1011216769 6:85013819-85013841 GCCTCTCCCTTGAAATTGGGAGG - Intergenic
1013127301 6:107196784-107196806 TCCCCTCCCCAGAAATTTGGGGG - Intronic
1013735262 6:113219667-113219689 ACTCCCCCCTAGAAAATGGGAGG + Intergenic
1016825565 6:148385604-148385626 TCCCCTCCCCAGAGGTTGGGAGG - Intronic
1017478724 6:154827812-154827834 GCCCCGCCCCAAAAAAGGTGTGG - Intronic
1017963107 6:159239551-159239573 GCCCCTGCCCAAAGAGTGGGAGG - Exonic
1018685069 6:166298013-166298035 GTCCCTCCCCAAGAAAGGGGTGG + Intergenic
1020406379 7:7840096-7840118 GCCCTGCCCCCCAAAATGGGGGG - Intronic
1022323592 7:29309749-29309771 AGCCCTACTCAGAAAATGGGAGG - Intronic
1024904648 7:54362726-54362748 GCCTCTCCCCAGAAACTGGGTGG + Intergenic
1025030142 7:55550074-55550096 GCTACTCCCCAGAACAAGGGAGG + Intronic
1027523710 7:79241416-79241438 GCCCTTCCCCAGAATAAGGGAGG - Intronic
1027523723 7:79241505-79241527 GCCTGTCCCCAGAATAAGGGAGG - Intronic
1028018529 7:85743635-85743657 GCCCCTCTACAGAATATGGGGGG - Intergenic
1032013342 7:128360672-128360694 GCCCAGCCCCAGGAAACGGGAGG - Intronic
1033247907 7:139733878-139733900 GCTCCTCCCCAGACCATGGTTGG - Intronic
1034311764 7:150094912-150094934 GACCCACCCCAGGGAATGGGAGG - Intergenic
1035264185 7:157681509-157681531 GACCCTCTCCAGAAAACTGGAGG + Intronic
1035769871 8:2138481-2138503 GCCCCTCCCCGGAAAGAGGCGGG - Intronic
1037095432 8:14980750-14980772 GTCCCTCCCCACAACATGTGAGG + Intronic
1037244380 8:16815382-16815404 GTCCCTCCCCAAAACATGTGAGG + Intergenic
1040798017 8:51308379-51308401 GCCCCTCCCCAGGACATGTGAGG - Intergenic
1044371239 8:91413499-91413521 GCCCCTCTCCAGCCACTGGGAGG + Intergenic
1048828012 8:138448370-138448392 GCCCCTTCCAAGAATAAGGGTGG + Intronic
1049850842 8:144829330-144829352 GCCCCTCCCCAGAATATTAGAGG + Intronic
1051523105 9:18012493-18012515 GCCCAGCCCCGGAAAATGGGTGG - Intergenic
1052943949 9:34152497-34152519 TCTCCTCTCCAGAAAATGGGAGG - Intergenic
1056978829 9:91288038-91288060 GCCTCCCCCCAGAAGCTGGGGGG + Intronic
1057424470 9:94937098-94937120 TCCCCTCCCCGGAGATTGGGGGG + Intronic
1057804227 9:98209182-98209204 GCCCTTCCCTAGATAAGGGGTGG + Intronic
1058945831 9:109855070-109855092 CCCCCACCCCAAAAAAAGGGGGG - Intronic
1060733460 9:126051867-126051889 GGCCCTGCCCAGGAAATGGCAGG - Intergenic
1061152487 9:128836759-128836781 GCCCCTCCCCTGCACATTGGTGG - Intronic
1062456837 9:136644064-136644086 GCCCCTCCCCAGAAGATCGCGGG + Intergenic
1185616025 X:1422577-1422599 GCCCCCTCCCACAGAATGGGAGG + Intronic
1190740982 X:53288524-53288546 GGCCCTCACCAGAAGATGAGGGG - Intronic
1195711484 X:107776424-107776446 CCCCCCCCCCAGAAAAAGGGGGG - Intronic
1199643137 X:149882212-149882234 GCCCCCTACCAGAAAGTGGGGGG - Intronic