ID: 1102932561

View in Genome Browser
Species Human (GRCh38)
Location 12:116873917-116873939
Sequence CAGGGGCACCAGTTTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102932556_1102932561 -10 Left 1102932556 12:116873904-116873926 CCCCACCCAACAGCAGGGGCACC 0: 1
1: 1
2: 3
3: 28
4: 282
Right 1102932561 12:116873917-116873939 CAGGGGCACCAGTTTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 136
1102932555_1102932561 -9 Left 1102932555 12:116873903-116873925 CCCCCACCCAACAGCAGGGGCAC 0: 1
1: 0
2: 2
3: 29
4: 295
Right 1102932561 12:116873917-116873939 CAGGGGCACCAGTTTAGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102932561 Original CRISPR CAGGGGCACCAGTTTAGAGC AGG Intronic
901421354 1:9153369-9153391 CAGGGTCACCTGTTTGGAGGAGG - Intergenic
903738782 1:25546115-25546137 CAGTGGCCACAGGTTAGAGCAGG + Intronic
903961135 1:27058555-27058577 CAGAGGCACCAGTTTTTAGGAGG - Intergenic
904585989 1:31580963-31580985 CGGGGGTCCCAGTTTAGAGTAGG + Intronic
907571757 1:55490441-55490463 CAGGGAGACCAGGTTAGAACTGG - Intergenic
911968740 1:104402470-104402492 CAGGGGCACCCTTATAGAGTAGG + Intergenic
913216469 1:116624853-116624875 CAGGTGCTCCAGTCCAGAGCTGG + Intronic
916728342 1:167543698-167543720 CAGAGGCACCCGGTCAGAGCGGG + Intronic
918056279 1:181024334-181024356 CAAGGTCACCAGTCTGGAGCTGG + Intergenic
920881614 1:209886168-209886190 CAGGGGCTCTAGTTTAAGGCAGG - Intergenic
923008991 1:230073429-230073451 CAGTGCCACCTGCTTAGAGCAGG - Intronic
924453195 1:244197892-244197914 CTGAGCCACCAGTTCAGAGCTGG - Intergenic
1062855052 10:775849-775871 CAGGGCCACCCCTTTAGACCTGG - Intergenic
1063077803 10:2733628-2733650 CGGCGGCACCAGCATAGAGCTGG - Intergenic
1067029739 10:42872151-42872173 CAGGGGCCCCAGTTTAGTTGAGG + Intergenic
1067088723 10:43255890-43255912 GAGGAGCACCAGTCTAGAGTGGG + Intronic
1067093267 10:43282510-43282532 CAGGGGCACCATTCCAGAGTGGG + Intergenic
1067832980 10:49621003-49621025 CTGGGGCCTCTGTTTAGAGCTGG - Intronic
1069697564 10:70398209-70398231 CAGGGGCAGCAGGTGAGTGCAGG + Intergenic
1073513455 10:104057067-104057089 CAGGGGCACCAGGCTGGCGCTGG + Exonic
1075836174 10:125454630-125454652 CAGGGGCAACTGTGCAGAGCAGG - Intergenic
1076410321 10:130244608-130244630 CAGGGACACCTGTCAAGAGCAGG - Intergenic
1076747477 10:132521677-132521699 CTGGGGACCCAGTTTAGAGCAGG + Intergenic
1082727650 11:56755813-56755835 CACGTCCACCAGTCTAGAGCTGG - Intergenic
1084707602 11:70824362-70824384 CAGAGGAACCAGATCAGAGCAGG - Intronic
1086256283 11:84880426-84880448 ATGGTGCACAAGTTTAGAGCTGG + Intronic
1088221974 11:107579055-107579077 CAGGTGTACCAGGTTAGAGTTGG + Intergenic
1090203854 11:124874346-124874368 CCGGGCCACCAGTATAGACCTGG - Intronic
1092473487 12:8798855-8798877 CAGCTGCACCATTTTACAGCAGG + Intergenic
1092663368 12:10764638-10764660 CATGGGAACCAGTCTGGAGCTGG + Intergenic
1092681891 12:10992510-10992532 CAGGGGGATCAGTTTAGCCCAGG - Intronic
1096436231 12:51592353-51592375 CAGGGGCCCCAGCTTCGAGTTGG + Intronic
1097310898 12:58117866-58117888 TGGGGTCACCAGTTTGGAGCAGG + Intergenic
1098461320 12:70735905-70735927 CACGGGCAGCAGCTTAGTGCAGG + Intronic
1102507400 12:113392350-113392372 CTGGGGCCCCAGTTGAGAGCTGG + Intergenic
1102914400 12:116742197-116742219 CAGGGGCAATAGTTTAGGACTGG + Intronic
1102932561 12:116873917-116873939 CAGGGGCACCAGTTTAGAGCAGG + Intronic
1105471500 13:20699087-20699109 CAGGGGCTCCAGGTTATAGTGGG + Intergenic
1107656191 13:42593855-42593877 CACTGGCACCAGCTTATAGCTGG - Intronic
1108820243 13:54340826-54340848 CAGTGAAACCAGTATAGAGCTGG + Intergenic
1114547342 14:23512577-23512599 CATGGGCACCAGCTGAGAACGGG + Intergenic
1115193291 14:30769867-30769889 CAGAGGCACCAGTCAGGAGCTGG + Intergenic
1118011645 14:61615974-61615996 CAAGGGCAGGAGGTTAGAGCAGG + Intronic
1119400453 14:74358920-74358942 AAGGGGGACCAGTTTGGAGAGGG + Exonic
1120037285 14:79712156-79712178 AAGGGTTACCAGTATAGAGCAGG - Intronic
1130551128 15:84890521-84890543 CAGGCTCACCAGTGCAGAGCAGG - Exonic
1133015707 16:2938508-2938530 CTGGGGCATCAGTTCTGAGCTGG - Intronic
1134274515 16:12763733-12763755 CATGGGCAGCAGTTGAGAACTGG - Intronic
1134296362 16:12949454-12949476 CAAGGGGTACAGTTTAGAGCAGG + Intronic
1138368358 16:56502391-56502413 CATGGACACCAGTGCAGAGCAGG - Exonic
1141408362 16:83814375-83814397 CAGGGGCACAAGGTCACAGCTGG + Exonic
1141670720 16:85490383-85490405 AAGGGGCAGCAGGGTAGAGCAGG + Intergenic
1141774293 16:86111877-86111899 CAGGGTCACCAGCTAAGAGGTGG - Intergenic
1142220310 16:88851054-88851076 CAGGGTCAGCAGATGAGAGCTGG - Intronic
1143405957 17:6677381-6677403 CTGGAACACCAGATTAGAGCAGG + Intergenic
1144573385 17:16414881-16414903 CAGGGAGACCAGTTTGGAGGTGG + Intergenic
1146461929 17:33052983-33053005 CAGAGACACCAGTTGAGAGAAGG + Intronic
1146541142 17:33696355-33696377 CAGAGGCAGCAGTTTAGGACCGG + Intronic
1151336811 17:73444708-73444730 CATAGGCACCAGTTTACAGATGG + Intronic
1151481544 17:74372584-74372606 CAGGGGCAGAAGTGTAGAGGAGG + Exonic
1152231456 17:79115893-79115915 CATGGGCACCAGCTCAGAGCAGG + Intronic
1152289178 17:79429189-79429211 CAGGGACACCAGCACAGAGCTGG + Intronic
1154159576 18:11971325-11971347 CAGGTGGATCAGTTTAGATCAGG - Intergenic
1158440261 18:57468967-57468989 AAGGGCCACCAGTTCAGAGCAGG + Intronic
1160006207 18:75070774-75070796 CAGGGGCATGAGCTTACAGCTGG - Intergenic
1161936644 19:7376401-7376423 CTGGGGCTCCAGCTCAGAGCTGG + Intronic
1165400540 19:35596827-35596849 CAAGGGCACGGGTTTAGAACAGG + Intergenic
1168110942 19:54191077-54191099 CAGGGTCACAAGGGTAGAGCGGG + Intronic
1168540139 19:57203142-57203164 CATGGTAAACAGTTTAGAGCTGG + Intronic
925922455 2:8646799-8646821 AAGGGGCCCCAGTGCAGAGCTGG + Intergenic
929983740 2:46705218-46705240 TAGGAGCCCCAGTTTATAGCCGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932943776 2:76202950-76202972 CAGGGTCTCCAGCTTAGAGATGG - Intergenic
934762061 2:96861853-96861875 CAGCTGCACCAGCTGAGAGCGGG + Exonic
937280292 2:120713059-120713081 CAGGGGACCCTATTTAGAGCTGG + Intergenic
937452049 2:122010068-122010090 CAGGGGCAGCAATGTAGAGACGG - Intergenic
940108753 2:150127405-150127427 CATGGGAACCAGTTTGAAGCAGG - Intergenic
940154415 2:150638851-150638873 CATGGGCACCTGTTTTAAGCTGG + Intergenic
943690739 2:190867302-190867324 AAGGAGCACCAGAATAGAGCAGG + Intergenic
946326489 2:218987067-218987089 CAGGGGCAGGAGGTAAGAGCTGG + Intergenic
948918789 2:241051902-241051924 CAGGGGCCCCAGCTCAGGGCTGG - Intronic
1169196404 20:3685054-3685076 CAGGAGCACCAGTATGGAGGTGG + Intergenic
1169354372 20:4895106-4895128 CAGGGGAACCACTTCGGAGCTGG + Intronic
1170003463 20:11640555-11640577 CAGATGCAAGAGTTTAGAGCGGG - Intergenic
1170994410 20:21338030-21338052 CCTGGGCTCCACTTTAGAGCAGG + Intronic
1180464248 22:15596751-15596773 CAGGAGCACCACTTTAGCCCAGG + Intergenic
1180817815 22:18803226-18803248 CAGGTGCTCCAGTCCAGAGCTGG + Intergenic
1181082986 22:20426263-20426285 CAGAGGCACCAGCGGAGAGCCGG - Exonic
1181204030 22:21237679-21237701 CAGGTGCTCCAGTCCAGAGCTGG + Intergenic
1182355135 22:29719537-29719559 CAGGAGCAGCAGGTAAGAGCTGG - Intergenic
1183083063 22:35469558-35469580 CAGGGTCACCTGTCTACAGCTGG + Intergenic
1183360277 22:37379730-37379752 CAGGGGTCTCAGTTCAGAGCTGG + Intronic
1183427688 22:37748250-37748272 GAGGAGCACCAGCTGAGAGCAGG - Intronic
1183663380 22:39234191-39234213 GTGGGGCAACAGTTTAGAGAAGG - Intronic
1203222891 22_KI270731v1_random:57736-57758 CAGGTGCTCCAGTCCAGAGCTGG - Intergenic
1203267938 22_KI270734v1_random:29077-29099 CAGGTGCTCCAGTCCAGAGCTGG + Intergenic
950457093 3:13099280-13099302 TAGGGGCACCAGAATATAGCTGG + Intergenic
956529297 3:70200148-70200170 CAGGGCCACCATTTTAGCTCTGG + Intergenic
959583192 3:108002646-108002668 CAGGAGCACCTCTTTAGATCTGG + Intergenic
960680681 3:120244205-120244227 CAGAGGCCCCATTTTGGAGCTGG + Exonic
960992305 3:123319858-123319880 CAGGGGCACCAGCAGAGGGCTGG + Intronic
961353618 3:126320024-126320046 CAGGGGGATCAGTGTAGACCAGG + Intergenic
963239114 3:142985419-142985441 GAGGGGCACCAGGTCAAAGCAGG + Intronic
964437658 3:156671579-156671601 CAGGAGGATCAGTTGAGAGCAGG - Intergenic
969869555 4:10096124-10096146 CAGGGGCACCAGTTTGTTCCAGG - Intronic
971845169 4:31909393-31909415 GAGGAGCACAAGTTTAGAACTGG - Intergenic
977604769 4:98972348-98972370 CAGGGGCATCAGTTGAGGTCAGG - Intergenic
978027564 4:103896572-103896594 CAGAGGCACCAGTGTAATGCTGG + Intergenic
982892725 4:160876574-160876596 CCCGGCCACCATTTTAGAGCTGG - Intergenic
986156084 5:5177302-5177324 CCAGGGGACAAGTTTAGAGCTGG + Intronic
990493392 5:56322916-56322938 CTGGGGCACCAGGCTAGGGCAGG + Intergenic
991931542 5:71757653-71757675 CAGGGCCACCAGTTCTCAGCTGG + Intergenic
992493837 5:77272063-77272085 AAGGGGCAGAAGTTTAGACCAGG - Intronic
993566734 5:89485681-89485703 CAGGGGCACCATATTTGAGGTGG - Intergenic
998316099 5:141184271-141184293 CCGGGGCACCAGCTCAGTGCAGG - Exonic
1002321100 5:178376483-178376505 CAGGGGCACCAATGCAGTGCAGG - Intronic
1002951079 6:1812156-1812178 CAGAGGCAACATTTTAGAGGAGG + Intronic
1003033406 6:2622300-2622322 CAGAGGCCACAGTTTATAGCAGG + Exonic
1005350520 6:24930434-24930456 CAGGGTAACCTGTTTAGATCAGG - Intronic
1005480684 6:26252414-26252436 CACGTCCACCAGTCTAGAGCTGG + Intergenic
1006338526 6:33433230-33433252 CAGGGGCAGCAGGTTGGAGTGGG + Intronic
1006521468 6:34573596-34573618 GAGGGGCAGCAGTTCAGAGCGGG - Intergenic
1007314959 6:40979704-40979726 CAGAGGCCCAAGGTTAGAGCAGG + Intergenic
1007404379 6:41625519-41625541 CAGGGGCAGCTGTTTATAGGTGG + Intergenic
1011711989 6:90064565-90064587 CAGGGGGACCAGTTAAGAAGAGG + Intronic
1013262782 6:108462672-108462694 CAGGAGAACCAGAATAGAGCTGG + Intronic
1019847827 7:3524205-3524227 CAGGGGCACCAGTTTGTATAGGG + Intronic
1021844620 7:24752446-24752468 CAGGGGAACAAGATTAGAGATGG + Intronic
1026513860 7:71049813-71049835 CATGGGGGCCAGTTTAGTGCTGG - Intergenic
1034212975 7:149381332-149381354 CAGGGCCACCAGTTTAGGACTGG + Intergenic
1037540297 8:19864392-19864414 CAGGGGGACCACTTTAGCCCAGG + Intergenic
1038468576 8:27790148-27790170 CAGCGGCAGGAGCTTAGAGCTGG - Intronic
1040980366 8:53240745-53240767 CAGGGGATCCAATTTACAGCAGG + Intronic
1041369518 8:57143758-57143780 CAGAGGCAACAGTTTCGAGGAGG + Intergenic
1043157158 8:76797419-76797441 CAGAGGCTCCAGTGTAGAACAGG - Intronic
1045438222 8:102185721-102185743 GAGGGGCACCAATTTGGAGAAGG - Intergenic
1045543821 8:103110816-103110838 CAGGGCCACCAGAGTAGAGTGGG - Intergenic
1050177101 9:2879712-2879734 CTGGAGCACCAGGTGAGAGCAGG + Intergenic
1053123273 9:35561303-35561325 CAGGGGCACCAGGCCAGAGTCGG - Exonic
1059235445 9:112756832-112756854 CAGTGGCACTATTTCAGAGCTGG - Intronic
1059743927 9:117181992-117182014 CAGGGACACCATTTCACAGCTGG - Intronic
1187621043 X:21055112-21055134 CAGGGGAACCACTTGAAAGCTGG + Intergenic
1199170267 X:144726905-144726927 CAGTGGCACAAGTTCAGTGCTGG + Intergenic