ID: 1102932626

View in Genome Browser
Species Human (GRCh38)
Location 12:116874277-116874299
Sequence CAGTCTTACCTCCGGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102932623_1102932626 -7 Left 1102932623 12:116874261-116874283 CCTGAAACGTACTATGCAGTCTT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1102932621_1102932626 26 Left 1102932621 12:116874228-116874250 CCTGGCACCAAGCTACACTGCTT 0: 1
1: 0
2: 2
3: 11
4: 162
Right 1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1102932622_1102932626 19 Left 1102932622 12:116874235-116874257 CCAAGCTACACTGCTTGTTTTTC 0: 1
1: 0
2: 4
3: 17
4: 425
Right 1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1102932620_1102932626 27 Left 1102932620 12:116874227-116874249 CCCTGGCACCAAGCTACACTGCT 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102932626 Original CRISPR CAGTCTTACCTCCGGGCCAC TGG Intronic
901493110 1:9606625-9606647 CAGCCTTACCTCGGTGCCAAGGG - Intronic
902233775 1:15044657-15044679 CAGCCTTACCTCCAGGGCTCAGG - Intronic
904318886 1:29683757-29683779 CAGTCTTACCTCTGGGTGCCTGG + Intergenic
905856822 1:41319962-41319984 CCGTCCTGCCTCTGGGCCACTGG - Intergenic
908322898 1:62995135-62995157 CAATCTCACCTGCAGGCCACTGG - Intergenic
909496820 1:76288143-76288165 CAGTCATACCTTAGGCCCACAGG - Intronic
916003012 1:160634622-160634644 CTGTCCTGCATCCGGGCCACGGG + Exonic
916570289 1:166019585-166019607 CAGTCTTACCTCAGGTCTTCAGG - Intergenic
921659923 1:217789530-217789552 AACTCTTACCTGCAGGCCACTGG - Intronic
1069856273 10:71442882-71442904 CAGTCCTGCCTCCCGGCCACAGG - Intronic
1070576905 10:77686267-77686289 GAGTCTTCCCCCCAGGCCACAGG + Intergenic
1081987272 11:47315092-47315114 CAGTCTCATCTGCTGGCCACTGG - Intronic
1081994547 11:47355118-47355140 CAGTCCTGCCTCTGGGCCCCGGG + Exonic
1082736699 11:56863917-56863939 AACTCTTTCCTCCAGGCCACGGG - Intergenic
1084520811 11:69661570-69661592 CAGTCTCTCCTCTGTGCCACTGG + Intronic
1085720395 11:78907266-78907288 CTGTCTTCCCTCCTGGCCATAGG - Intronic
1088983913 11:114888995-114889017 CAGTCTTACCACCTGTCCCCGGG - Intergenic
1092161244 12:6316566-6316588 AAGTCTGACCTCTGTGCCACAGG + Intronic
1092377166 12:7965776-7965798 CAGCCTCACCTCCTGGCCTCAGG + Intergenic
1093418637 12:18949347-18949369 AAGTCTTACATCCTGGCCAAGGG + Intergenic
1097153143 12:56994386-56994408 CAGTATGACCTCCCCGCCACTGG + Intergenic
1097450717 12:59734065-59734087 CAGTCTGACCCCCAGGCCTCAGG + Intronic
1102932626 12:116874277-116874299 CAGTCTTACCTCCGGGCCACTGG + Intronic
1102976537 12:117210789-117210811 CAGTTTTCCCTCCGGGCATCTGG + Exonic
1106308912 13:28535567-28535589 CAGTTTTCCCTCCAGTCCACAGG - Intergenic
1112738694 13:102450358-102450380 CAGTCTTACCTGCTGGGCCCTGG + Intergenic
1113825896 13:113252787-113252809 CAGTCTTCACTCTGTGCCACTGG + Intronic
1114526526 14:23370178-23370200 CTCTCTTTCCTCAGGGCCACAGG + Intergenic
1119384960 14:74252285-74252307 CAGTCTTTCCTTCGAGGCACAGG + Intronic
1121320873 14:92990992-92991014 CAGTCTTACTGCCGGGGCAGGGG + Intronic
1122269784 14:100563685-100563707 CAGTGGAACCTCCGGGGCACAGG - Intronic
1128398914 15:67256574-67256596 CAGTCTTCGCTCCTGGCTACTGG - Intronic
1134056839 16:11175348-11175370 AAGTCTGACTTCCTGGCCACGGG - Intronic
1139356993 16:66372485-66372507 CAGGCATAGCTCCGGCCCACAGG - Intronic
1139429853 16:66905255-66905277 CAGACTGACCTCTGGGCCTCCGG + Intergenic
1139635273 16:68254875-68254897 CAGTGTCCCCTCCGGGTCACTGG + Intronic
1145262658 17:21364115-21364137 CAGTTTTACCTGCAGGCCCCAGG - Intergenic
1151545459 17:74790322-74790344 CGCACTTCCCTCCGGGCCACAGG + Intronic
1157117071 18:44871857-44871879 GAGCCTGGCCTCCGGGCCACAGG + Intronic
1164911261 19:32013888-32013910 CAGTGTCACCTCCAGGGCACTGG - Intergenic
1167281818 19:48573606-48573628 TAGTCCTACCTCTGGGCCCCTGG - Intronic
1168148338 19:54431581-54431603 CAGTCCTACCTCCTGACCAAGGG + Intronic
925023139 2:587607-587629 CAGCCTTTCCTCAGGGCCACAGG + Intergenic
927341558 2:21989470-21989492 CAGTATTACCTCTGGGCTTCTGG + Intergenic
935304941 2:101728289-101728311 CAGTCTTACCTCAGAACTACTGG - Intronic
935372242 2:102358678-102358700 CAGTCTGTCCTCCAGACCACTGG + Intronic
936026034 2:109031750-109031772 AACGCCTACCTCCGGGCCACAGG + Intergenic
939688520 2:145228685-145228707 CAGTCCTGGCTCCTGGCCACCGG + Intergenic
940468660 2:154064744-154064766 CAGTCTTACCCAAGGCCCACTGG - Intronic
940542048 2:155032647-155032669 CATTCTTACTTCAGGGCCATAGG + Intergenic
945235779 2:207630155-207630177 CAGTCCTTCCACCTGGCCACAGG + Intergenic
1180968964 22:19805068-19805090 CAGGCTCACAGCCGGGCCACAGG - Intronic
1185173016 22:49304436-49304458 CAGCCCTGCCTCCCGGCCACAGG + Intergenic
949887238 3:8705803-8705825 CTGTCTGAGCTCCAGGCCACAGG - Intronic
955012911 3:55036962-55036984 CAGACTCACCTCCTGGCCACTGG - Intronic
959608246 3:108265561-108265583 CAGTCTTTCCACAGGGCAACTGG - Intergenic
961070433 3:123919211-123919233 CAGTTTTGCCTCCTGGCCTCAGG - Intronic
977369500 4:96117298-96117320 CTGTCTTACCTCCTGGCCCAAGG - Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
985056155 4:186037269-186037291 AATTCTTACCCCCGTGCCACTGG - Intergenic
985839051 5:2291807-2291829 AATGCTTACCTCAGGGCCACTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
997921192 5:137980991-137981013 CAGCCTTACCTCCTGGGCTCAGG + Intronic
999254084 5:150200000-150200022 CATTCCATCCTCCGGGCCACAGG - Intronic
1009349316 6:62653976-62653998 CAGTGTTACCTGAAGGCCACTGG - Intergenic
1012136264 6:95560992-95561014 CAGTCTTACCTCCAGCCCTAAGG + Intergenic
1012546658 6:100427115-100427137 CAGAGTTACCGCCTGGCCACTGG + Intronic
1024675096 7:51631165-51631187 CTGTCTCACCTCCGTGCCTCGGG + Intergenic
1028260541 7:88658887-88658909 CAGTCTGAACTCCTGGCCTCAGG - Intergenic
1033324247 7:140364038-140364060 CAGTCTTATCTCCTGGCCTCAGG - Intronic
1038276355 8:26124442-26124464 CAGTCAATCCTCCTGGCCACTGG + Intergenic
1045395884 8:101760285-101760307 CAGCTTTACCTCCAGGCCAGTGG + Intronic
1047416032 8:124665403-124665425 CAGTCTCACCTTTGGGCCCCTGG + Intronic
1047814732 8:128450840-128450862 CAGTCTTACCTCTGGGCCCGAGG + Intergenic
1053198522 9:36137391-36137413 CAGTCCTGCCTTCGGGCCCCTGG + Intronic
1057956296 9:99410812-99410834 CAATATCACCTCCTGGCCACAGG - Intergenic
1060508167 9:124214008-124214030 CAGTCTGACCTCAGAGCCTCTGG - Intergenic
1061365109 9:130168583-130168605 CAGGCTGACCCCCGGGCCCCAGG + Intergenic
1062364101 9:136200830-136200852 CAGTCTCCCCTCCGGCCCACAGG + Intronic
1192245081 X:69365361-69365383 CATTCTGACCTCCTGGACACTGG + Intergenic