ID: 1102933597

View in Genome Browser
Species Human (GRCh38)
Location 12:116879909-116879931
Sequence AGGCTGAGCCCACCATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102933597_1102933602 22 Left 1102933597 12:116879909-116879931 CCCATCTATGGTGGGCTCAGCCT 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1102933602 12:116879954-116879976 GCAGCGCTCCTCGCTACTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102933597 Original CRISPR AGGCTGAGCCCACCATAGAT GGG (reversed) Intronic
903211692 1:21822585-21822607 AGGCAGAGCCCAGCACTGATAGG - Exonic
903398907 1:23024369-23024391 AAGCTGAGGCCAGTATAGATAGG + Intronic
903759764 1:25689738-25689760 AGGCTGAGCCCTGCAGACATGGG + Intronic
904901069 1:33857507-33857529 AGGCAGAGCACAACAGAGATGGG - Intronic
906289514 1:44610650-44610672 AGGCCGAGCCCACCAGAGGCAGG - Intronic
909720838 1:78767601-78767623 AGGCAGAGCCTACCTGAGATGGG + Intergenic
910485272 1:87706220-87706242 AGGCTGAGCCAACTCTAGATTGG - Intergenic
911411238 1:97510175-97510197 AGGCAGAGCCAACAGTAGATAGG + Intronic
912822603 1:112879753-112879775 AGGCTGAGACCACATTAGCTGGG + Intergenic
912966265 1:114239973-114239995 GGGCAGAGCCCACCACAGCTTGG + Intergenic
915682329 1:157593363-157593385 AAGCTGAGCCCACCAAAGTTAGG - Intronic
919604604 1:199666512-199666534 ATCCTGAGCCCACTATTGATTGG - Intergenic
922153425 1:223023409-223023431 AGGGTGGGCCCAGCCTAGATGGG - Intergenic
923265387 1:232308722-232308744 AGTCTGAGCACAGCATAGCTGGG - Intergenic
924493981 1:244568586-244568608 GGGCGGAGCCCACCACAGCTCGG - Intronic
1062940802 10:1419532-1419554 AGGCTGTGCCCTCCATAAAGTGG - Intronic
1065967452 10:30781342-30781364 AGGCTGAGGCCCCCAGCGATGGG - Intergenic
1067251634 10:44591655-44591677 AGGCGGTGCCCAGCATAGACAGG - Intergenic
1070582041 10:77728496-77728518 AGATTGAACCCACTATAGATGGG - Intergenic
1072493677 10:95934123-95934145 AGGCAGAGCCCACCACAGCTTGG - Intronic
1072796029 10:98355190-98355212 ATGCTGAGCTCACCATAGCTAGG - Intergenic
1074344004 10:112663258-112663280 AGAATGAGCCTGCCATAGATAGG - Intronic
1077767657 11:5178445-5178467 CGGCTGAGGCCAGCATGGATAGG + Exonic
1078392883 11:10952008-10952030 CGGCAGAGCCCACCACAGCTCGG - Intergenic
1079013224 11:16846761-16846783 AGCCTGAACCCACCATATCTTGG + Intronic
1079085257 11:17440470-17440492 AGGCTAAGCACTCCATAGACAGG - Intronic
1082977409 11:59087013-59087035 AGGCTGAGATCCCCAGAGATGGG - Intergenic
1086300319 11:85420675-85420697 GGGCAGAGCCCACCACAGCTTGG - Intronic
1087921913 11:103876489-103876511 AGGCTGGGCTCACCATCAATTGG + Intergenic
1088752670 11:112857869-112857891 AGGCTGAGGCCACCATGTCTAGG - Intergenic
1089480932 11:118804512-118804534 AGGCTGTGCGCAGAATAGATGGG - Intergenic
1092276182 12:7062510-7062532 ATGCTGAGCCTACCATGTATGGG + Exonic
1093835582 12:23824831-23824853 GGGCAGAGCCCACCACAGCTCGG - Intronic
1093884684 12:24446276-24446298 AGACTGAGACTACCCTAGATTGG + Intergenic
1096617767 12:52843905-52843927 AGGCTGAATTCACCCTAGATGGG + Intronic
1098374554 12:69800246-69800268 AGGATGAGCCCACAATGGACAGG + Exonic
1098592928 12:72235597-72235619 CAGCTGAGCCCTTCATAGATTGG - Intronic
1102755420 12:115335609-115335631 AGGCTGAGCCCACAATTCCTCGG - Intergenic
1102933597 12:116879909-116879931 AGGCTGAGCCCACCATAGATGGG - Intronic
1103627466 12:122230939-122230961 AGGCTGAGGTCACCAGAGAGGGG + Exonic
1105009435 12:132745565-132745587 TGGCAGAGCCCACCATGGACAGG - Intronic
1107346023 13:39461795-39461817 AGTCTCAGCCCAGCATACATTGG + Intronic
1112119981 13:96399015-96399037 AGTCTGGGCCCAGCATAGCTGGG - Intronic
1113673617 13:112193604-112193626 AGGCTGAGGCCACCATCAGTGGG + Intergenic
1114840123 14:26253318-26253340 AGTCTGAGCCCAACACAGAGAGG + Intergenic
1115856242 14:37632853-37632875 GGGCAGAGCCCACCACAGCTTGG - Intronic
1119472905 14:74910344-74910366 AGGCTGGGCCCACTTTAGTTGGG - Intronic
1120843141 14:89104567-89104589 CGGCTGAGTCCACCACAGCTCGG - Intergenic
1121321255 14:92992947-92992969 AGTCTGAGACCACCATTTATTGG - Intronic
1123058564 14:105584094-105584116 GGGATGAGCCCACAGTAGATGGG - Intergenic
1125227191 15:37408552-37408574 GGGTGGAGCCCACCATAGCTTGG + Intergenic
1125441845 15:39711505-39711527 AGGCTTAGCCCGCCTTGGATTGG + Intronic
1131177969 15:90221615-90221637 AGGCTGAGGCCACAAAAGCTGGG - Exonic
1134019429 16:10911118-10911140 AGGGGCAGCCCACCATACATGGG + Intronic
1134370060 16:13614985-13615007 AGGGTGAGCTCAGCAGAGATGGG + Intergenic
1136173801 16:28504041-28504063 AGGCTGAGCCCTGGAGAGATGGG + Exonic
1139358008 16:66378914-66378936 AGGCAGTGGCCACCATATATGGG + Intronic
1139654694 16:68380298-68380320 AGGCTGAGCCCAAGACAGAGAGG + Intronic
1142345020 16:89548427-89548449 AGGCTGAGCCCACCACACCCAGG - Intronic
1143496862 17:7317423-7317445 AGGCTCAGCCCACCTTGCATGGG + Intronic
1145037916 17:19554028-19554050 AGCCTGAGACCACCAGAGACAGG + Intronic
1145284698 17:21496484-21496506 AGGCTGAGCGCACCACAGGGAGG - Intergenic
1146931232 17:36779583-36779605 AGTCAGAGCCCAACAGAGATTGG + Intergenic
1148492645 17:48033222-48033244 AGGATGAGCCCACCACGTATAGG + Exonic
1152260318 17:79263187-79263209 AGCCTGAGCCCTCCAAAGGTTGG - Intronic
1157279629 18:46337532-46337554 AGGCTGGGCCCACCATGCTTCGG - Intronic
1160466635 18:79083149-79083171 AGGCAGAGCCCACCACACCTTGG - Intronic
1162327798 19:10009210-10009232 AGACTGAGCTCACCTTAGAAAGG + Intronic
1163250547 19:16124147-16124169 AGGGTGTGCCCACCGTGGATGGG + Intronic
1164574745 19:29399189-29399211 AGGCTGTGCCCTCCACGGATGGG + Intergenic
1166023607 19:40056309-40056331 AGGTTGATCCCAGCATACATTGG + Intergenic
926246274 2:11124074-11124096 AGGCTGGGACCACCCTACATGGG + Intergenic
928949399 2:36800937-36800959 ACGCTGAGCACTCCACAGATGGG + Intronic
937139836 2:119590548-119590570 TGGCTGAGCCCAGCTGAGATGGG - Intronic
938698427 2:133855137-133855159 TGGCTGAGCCCACCTGAGGTGGG - Intergenic
944272442 2:197798379-197798401 TGGCTGAGCCCACTGTAAATGGG + Intergenic
945207240 2:207344853-207344875 GGGCAGAGCCCACCACAGCTTGG + Intergenic
945921437 2:215758970-215758992 AGCCTGAGCCCACTAAAGACCGG - Intergenic
1172968589 20:38857018-38857040 TGGCTGTGCCCACCGTAGGTGGG - Intronic
1180139303 21:45881952-45881974 AGGCTGATTCCACCATATCTAGG + Intronic
1180899118 22:19358238-19358260 AGGCTCTGACCACCAGAGATGGG - Intronic
1183694683 22:39415047-39415069 AGGCTGAGCCAACCCCAGAGAGG - Exonic
1183947618 22:41335645-41335667 AGTGTCTGCCCACCATAGATTGG - Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
951741693 3:25931866-25931888 AGGCAGAGCCCACCGCAGCTAGG + Intergenic
953052908 3:39362069-39362091 AGGCTGAGCCCACCTGAGATAGG + Intergenic
953433368 3:42857919-42857941 GGGCAGAGCCCACCGTAGCTTGG + Intronic
953773843 3:45799220-45799242 AGTCTCAGCCATCCATAGATAGG + Intergenic
956383048 3:68686198-68686220 GGGCGGAGCCCACCACAGCTAGG - Intergenic
957776514 3:84761407-84761429 GGGCAGAGCCCACCACAGCTTGG + Intergenic
957970674 3:87377891-87377913 GAGCTTAGCCAACCATAGATAGG + Intergenic
960491619 3:118322356-118322378 GGGCAGAGCCCACCACAGCTAGG - Intergenic
961395002 3:126580470-126580492 TGGAGGAGCCCACCATGGATGGG + Intronic
965261382 3:166489815-166489837 AGCCGGAGCCCAGCATACATAGG + Intergenic
966948605 3:184795909-184795931 TGGTTGAGCCCATCATATATGGG - Intergenic
971384690 4:26132375-26132397 TGGCTGAGCCCACCCTAATTAGG - Intergenic
975051197 4:69866963-69866985 AGGCTGATACCACTGTAGATGGG - Intergenic
975056723 4:69942325-69942347 AGGCTAAGCTCACTATAGTTTGG - Intronic
975149389 4:71004702-71004724 GGGCAGAGCCCACCACAGCTTGG - Intronic
978108289 4:104930956-104930978 GGGCGGAGCCCACCACAGCTTGG + Intergenic
981481454 4:145243239-145243261 GGGCAGAGCCCACCACAGCTTGG - Intergenic
982825748 4:160002050-160002072 GGGCAGAACCCACCATAGCTTGG + Intergenic
983543308 4:168935658-168935680 GGGCAGAGCCCACCACAGCTTGG + Intronic
984269809 4:177536855-177536877 GGGCAGAGCCCACCACAGCTTGG - Intergenic
985424218 4:189812660-189812682 AGGCTGAGCATCCCATGGATAGG - Intergenic
992870828 5:81003867-81003889 AGGCTCAGCTCACCATGGTTTGG - Intronic
993686574 5:90945309-90945331 AGACTGAGCCCACCAAAACTAGG + Intronic
995552718 5:113296495-113296517 TGGCTGAGCCCAGCAGAGATGGG + Intronic
997370729 5:133357999-133358021 AGGCTGAGCTGACCACAGACTGG - Intronic
997528198 5:134566876-134566898 AGGCTGAGAGCACCAGAGCTAGG + Intronic
997641530 5:135451813-135451835 AGGCTGAGCCCAGGACAGGTGGG + Intronic
1000470122 5:161630511-161630533 AAGCTTAGCCCACCATAATTAGG - Intronic
1001121624 5:168985589-168985611 ATGCTGCGCCCACCATGCATAGG - Intronic
1002944824 6:1750968-1750990 CGGCGGAGCCCACCACAGCTTGG + Intronic
1004603136 6:17169996-17170018 GGGCTGAGCCAGCCATGGATGGG + Intergenic
1004944459 6:20596406-20596428 GGGCAGAGCCCACCACAGCTCGG - Intronic
1011298917 6:85853630-85853652 GGGCAGAGCCCACCACAGCTTGG - Intergenic
1015211336 6:130702016-130702038 GGGCGGAGCCCACCACAGCTCGG + Intergenic
1015471891 6:133615008-133615030 ATGCTGAGCCCACCAAAGCTTGG + Intergenic
1015802094 6:137070530-137070552 GGGCAGAGCCCACCACAGCTCGG + Intergenic
1020874250 7:13673763-13673785 GGGCGGAGCCCACCACAGCTCGG - Intergenic
1022515889 7:30974790-30974812 AGGGTGAGCCCAGCCTGGATTGG + Intronic
1023511607 7:40959411-40959433 GGGCAGAGCCCACCACAGCTTGG - Intergenic
1024324941 7:48102102-48102124 AGGGTGAGCCCACAGTAGCTGGG + Intronic
1029196510 7:98809358-98809380 TGGCTGAGCCCAACATCAATGGG - Intergenic
1030141019 7:106304230-106304252 GGGCAGAGCCCACCACAGCTCGG - Intergenic
1033161775 7:139003313-139003335 GGGCTGAGTCCAGCATAGGTAGG - Intergenic
1033578136 7:142705838-142705860 AGGCTGACTCCAGCATAGCTAGG - Intergenic
1034404495 7:150893443-150893465 AGTCTGAACCCAGCAGAGATTGG + Intergenic
1039282997 8:36006808-36006830 GGGCAGAGCCCACCACAGCTTGG + Intergenic
1040444731 8:47482282-47482304 AGGCTGAGCCGAGCATAGTGGGG + Intronic
1042630041 8:70806061-70806083 AGGCTGAGAACAGCAAAGATGGG - Intergenic
1044483851 8:92726112-92726134 TGGCTGAGCCGACCACAGAAAGG - Intergenic
1044597879 8:93976236-93976258 ATGCAGAGCCCACCAAAAATAGG - Intergenic
1047748712 8:127864338-127864360 AGGCTGAGGCTCCCAGAGATTGG - Intergenic
1051983066 9:23047202-23047224 AGACTGAGCCTACAATTGATTGG + Intergenic
1052891611 9:33705639-33705661 AGGCTGACTCCAGCATAGCTAGG - Intergenic
1061773823 9:132947146-132947168 GGGCTGAGCCCTCCATAGGCGGG + Intronic
1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG + Intergenic
1191824864 X:65353860-65353882 GGGCAGAGCCCACCACAGTTTGG + Intergenic
1192755811 X:74046344-74046366 GGGCAGAGCCCACCACAGCTCGG - Intergenic
1192938000 X:75881392-75881414 GGGCAGAGCCCACCACAGTTTGG - Intergenic
1193037809 X:76972608-76972630 AGGCGGACTCCACAATAGATGGG - Intergenic
1196946573 X:120832805-120832827 GGGCAGAGCCCACCACAGCTTGG - Intergenic
1198519014 X:137433777-137433799 AGGCAGAGCCCACCGCAGCTTGG + Intergenic
1200249413 X:154544646-154544668 AGGTGGAGCCCACAGTAGATTGG - Intronic