ID: 1102934141

View in Genome Browser
Species Human (GRCh38)
Location 12:116882602-116882624
Sequence GGTGAAATGACAACAAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102934138_1102934141 -5 Left 1102934138 12:116882584-116882606 CCTTTTGGCCCACAGCGTGGTGA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 208
1102934137_1102934141 -4 Left 1102934137 12:116882583-116882605 CCCTTTTGGCCCACAGCGTGGTG 0: 1
1: 0
2: 0
3: 9
4: 229
Right 1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102934141 Original CRISPR GGTGAAATGACAACAAAGTC AGG Intergenic
900184444 1:1326376-1326398 GGTCAGATGACAACAAAGACAGG - Intronic
902343039 1:15796978-15797000 GGTGAAATCCCAGTAAAGTCTGG + Intergenic
903554836 1:24186062-24186084 GGTGAAAGTACAAGAAGGTCTGG + Intronic
904689804 1:32285478-32285500 GGTGAAAGGACATCAAGGTCAGG - Intronic
904877144 1:33663995-33664017 GGTGAAATTCAAATAAAGTCTGG - Intronic
905549897 1:38829137-38829159 GGTGATTTAACAACAAATTCTGG - Intergenic
907591753 1:55680545-55680567 AGTGAAAAGACAAAAAAGTAGGG - Intergenic
908859505 1:68467460-68467482 TCTGAAATGGCCACAAAGTCTGG - Intergenic
909461107 1:75915325-75915347 AATGAAAGGACAACAAACTCTGG - Intergenic
909479820 1:76119143-76119165 TGTGAAGTGACTACAAACTCAGG - Intronic
910027327 1:82671192-82671214 GGTGAAAAGAGAACAAAGGACGG - Intergenic
910664428 1:89709177-89709199 GGTGAAATGAGAAGAATGTGGGG + Intronic
914696464 1:150085994-150086016 TGTGATATGACAACACAGGCTGG - Intronic
914862156 1:151395797-151395819 CTGGAAATGACACCAAAGTCAGG + Intergenic
914874437 1:151502225-151502247 GGTTAAATTACAGCATAGTCTGG - Intergenic
915205034 1:154263791-154263813 GGGGAAAGGACAAAAAAGTTTGG + Intronic
915640001 1:157217387-157217409 GGTCACAGGTCAACAAAGTCTGG + Intergenic
916225897 1:162489346-162489368 AGTGAAATGAAAGCAAAGTAAGG + Intergenic
919082387 1:192882197-192882219 GGTTAAAAGACAACAAAATATGG + Intergenic
919716887 1:200787593-200787615 GTTGAAATGACAACAAACAATGG + Intronic
921418597 1:214919898-214919920 AGAGACATGACAACAAAGCCAGG - Intergenic
922201256 1:223403463-223403485 GGGGAAAAGACACCAAAGTAGGG - Intergenic
922293094 1:224225337-224225359 GGTGGAAGGATAACAAGGTCAGG + Intergenic
923266410 1:232318854-232318876 GCTGAAATGATAACAAAACCTGG - Intergenic
923757077 1:236801598-236801620 ATTGAAATGACAAAAAAGTGAGG - Intronic
924254410 1:242168383-242168405 GGTGAGATGACAAAAATGTTTGG + Intronic
1064230471 10:13525511-13525533 TGTGAAAGGAGCACAAAGTCAGG + Intronic
1066348659 10:34615881-34615903 GGTGAGATGACATCACAGTGTGG - Intronic
1070117593 10:73543707-73543729 GGTGAAATCTGAATAAAGTCTGG - Intronic
1072039302 10:91591877-91591899 GGTGAAATGAGAAAAAGGCCAGG + Intergenic
1073663392 10:105503167-105503189 GGTGAAATTTGAACAAAGTTTGG - Intergenic
1073671151 10:105591583-105591605 GGTGAAATGAGAAAAGAGGCAGG - Intergenic
1075297614 10:121292039-121292061 GGGGAAATGAAAACCAAGCCGGG - Intergenic
1076238302 10:128882917-128882939 GGTGAAAGGACAAATAAATCAGG + Intergenic
1077923911 11:6661794-6661816 GGTGAAATCAGAACAGAGTCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082216557 11:49577247-49577269 CGTGAAATGACAAAAATGTGAGG - Intergenic
1083407287 11:62466493-62466515 GGAGAAATGAGAAGAGAGTCTGG - Intronic
1086302304 11:85440428-85440450 GGAGAAATGAGAAAAATGTCTGG - Intronic
1086418754 11:86616854-86616876 GGTGAAATCCAAAGAAAGTCTGG + Intronic
1087593901 11:100229116-100229138 GGGCAAATCACAACAAAGTAAGG + Intronic
1087809295 11:102593088-102593110 GGTCACATAACAGCAAAGTCAGG + Intronic
1088768596 11:113010803-113010825 AGTTACATGACAATAAAGTCAGG + Intronic
1090423209 11:126589822-126589844 GATGAAATGCCAGCAAGGTCAGG - Intronic
1092998864 12:13977158-13977180 GGTGAAATGACAGGAAAGGAGGG - Intronic
1095290389 12:40472886-40472908 GGTGAATTGACAACACTGGCAGG + Intronic
1097655762 12:62360916-62360938 TGTCAAATGACAACTCAGTCAGG + Intronic
1101387318 12:104269199-104269221 GTTGAAATGACAACAAGGGCTGG - Intronic
1102451915 12:113048264-113048286 AAAGAAGTGACAACAAAGTCTGG + Intergenic
1102691060 12:114761491-114761513 GTTAAAAAGAAAACAAAGTCGGG - Intergenic
1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG + Intergenic
1103493594 12:121343551-121343573 GGTGGAAAGACAACATAGTGTGG - Intronic
1105710217 13:23000878-23000900 TATGATATGACAATAAAGTCAGG - Intergenic
1106031309 13:26007636-26007658 GGTGAAATATAAACAAAGGCAGG + Intronic
1106902816 13:34372181-34372203 GGTGAAATGCAAATATAGTCTGG + Intergenic
1109077083 13:57849610-57849632 GTTGAAATGGCAACAAAGAATGG - Intergenic
1109477331 13:62898243-62898265 GGTGAAATTATATCAAATTCTGG + Intergenic
1111555776 13:89879769-89879791 GGTGAAATTGAAACAAGGTCAGG - Intergenic
1113712594 13:112478323-112478345 GGTTAAATGACAGCAAAGGCTGG + Intergenic
1115346708 14:32350561-32350583 GGTGAAATACAAATAAAGTCTGG + Intronic
1115494694 14:33991642-33991664 GGTGAAAGGAGAACAAGGTTTGG + Intronic
1118336574 14:64858441-64858463 TATGAAATGAGAACACAGTCAGG + Intronic
1124067975 15:26363689-26363711 GGTGAGATGGCAATTAAGTCGGG + Intergenic
1127693753 15:61423551-61423573 GGTGAAATCCAAATAAAGTCTGG - Intergenic
1129913601 15:79248160-79248182 GGTGAAAAGAAAGCAATGTCAGG - Intergenic
1132337423 15:101057267-101057289 GGTGAAGTAACACAAAAGTCGGG - Intronic
1133686694 16:8171709-8171731 GTTAAAATGAAAACAAAGGCCGG - Intergenic
1138221348 16:55254087-55254109 AGTGAAATGCTAATAAAGTCTGG + Intergenic
1139841117 16:69881490-69881512 GGTGAAATCCAAATAAAGTCTGG + Intronic
1141279549 16:82618675-82618697 GGTGACATCAAAACAAATTCTGG + Intergenic
1141678040 16:85527831-85527853 GGTGGAATGGGAACAGAGTCAGG + Intergenic
1142900658 17:3009540-3009562 GGTGGAATCTTAACAAAGTCAGG - Intronic
1142953503 17:3504206-3504228 GGCAAAGTGGCAACAAAGTCAGG - Intronic
1144243308 17:13335683-13335705 GCTGACATGACAACAAAATAGGG - Intergenic
1146502985 17:33380463-33380485 GGAGAAAAAACAACAAGGTCAGG + Intronic
1146680642 17:34805283-34805305 GGTGACAAGATAAAAAAGTCAGG + Intergenic
1149892455 17:60402049-60402071 AGTGAAATGAAAACAAAGGTGGG + Intronic
1150704051 17:67471807-67471829 GGTGAAATCTGAAGAAAGTCGGG - Intronic
1150803728 17:68302382-68302404 GCTGAAATAACAAGAAGGTCGGG - Intronic
1152142085 17:78542543-78542565 GGTGAAATTACTACCAAGTGAGG + Intronic
1153445454 18:5167432-5167454 GTAGACATGACAACAAAATCAGG + Intronic
1153990752 18:10397315-10397337 GATGAAATGAAAACAAGCTCAGG + Intergenic
1158037175 18:53046956-53046978 GGTGAAAGGAGAACAAACACAGG - Intronic
1159089791 18:63834926-63834948 GGGGAATTTACAACAAATTCTGG - Intergenic
1159529927 18:69642668-69642690 GGAAAAATTACAACAAATTCAGG - Intronic
1160366954 18:78334748-78334770 GGGAAAATGACACCAAAATCTGG - Intergenic
1160607797 18:80065600-80065622 GGTGAAATGAAAACACACACAGG + Intronic
1163608681 19:18290148-18290170 TATGAAATGAGAGCAAAGTCAGG + Intergenic
1166064480 19:40349141-40349163 GGAGAAATGGCAACAAAAGCAGG - Intronic
1167382771 19:49148389-49148411 GGTGAAAGGAGCACAGAGTCAGG - Intronic
1168150812 19:54447470-54447492 GGTGAAATCCCAGTAAAGTCTGG + Intergenic
1168435328 19:56312585-56312607 GGGGAAATGTGAATAAAGTCTGG + Intronic
1168578538 19:57534329-57534351 GGTCAAATAACACCAAGGTCAGG + Intronic
927127684 2:20027632-20027654 GGTGGAATGAACACAAAGTTTGG - Intergenic
927823820 2:26293229-26293251 GGTGAAATCTGAATAAAGTCTGG + Intergenic
929192736 2:39154695-39154717 GGTGAAATTCAAATAAAGTCGGG - Intergenic
931082693 2:58793046-58793068 AATGAAATGACAATAAAGACAGG + Intergenic
932251380 2:70247514-70247536 CGAGAAATGCCAACAAAGGCAGG + Intronic
932452294 2:71819496-71819518 GGTAAAATACCAATAAAGTCAGG + Intergenic
933173304 2:79149245-79149267 GGTGAAATGAGAGCAAGGACTGG - Intergenic
936173514 2:110197674-110197696 AGTGGAATGACATCAAAGGCTGG + Intronic
936345371 2:111671673-111671695 GGTGAAAGGGCAACAAAGGAGGG + Intergenic
940866479 2:158822693-158822715 TGTGAAATGACAAAAATGTCAGG + Intronic
940905719 2:159167727-159167749 GGGGATATGCCAACACAGTCAGG + Intronic
941705993 2:168658400-168658422 GGAGTAATCACAACAAAGCCAGG - Intronic
942153616 2:173104535-173104557 AGTGAAATGTCAATAAAGCCTGG + Intronic
942240618 2:173961501-173961523 GGTGAAACGCAAACAAAGTCTGG + Intronic
943635668 2:190304152-190304174 GGTGAAATCCAAATAAAGTCTGG + Intronic
944620941 2:201515521-201515543 GGTGTAATAACACCATAGTCAGG + Intronic
946304935 2:218851102-218851124 GGGGCAATGACATCAAAGGCAGG - Intergenic
948662766 2:239517030-239517052 GGGGAAATGAAAGCAAAGTGGGG - Intergenic
1169696103 20:8388435-8388457 GGTGAAATCTGTACAAAGTCAGG - Intronic
1170985247 20:21251903-21251925 GGTGAAATGTGAGTAAAGTCTGG + Intergenic
1171125428 20:22598054-22598076 GGTAAAATGAAAACAAAACCTGG + Intergenic
1171442720 20:25178246-25178268 GGTGAAATGAGAACAACCGCAGG + Intergenic
1172635796 20:36408856-36408878 GGTGAAATCCAAATAAAGTCTGG + Intronic
1173582331 20:44156188-44156210 AGTGAAATGCAAATAAAGTCTGG + Intronic
1175059939 20:56232796-56232818 GGTGAAATCAAAATAAAGCCTGG + Intergenic
1176019658 20:62956191-62956213 GGAGAAAAGACCACCAAGTCGGG - Intronic
1178177566 21:30120746-30120768 AGTGAAATGACAATGAAATCAGG - Intergenic
1178266846 21:31151328-31151350 GGTGAATGGATAACAAAGTGTGG + Intronic
1178735639 21:35147509-35147531 GGGGAAATGACCAGAAAGTTCGG - Intronic
1182761006 22:32722333-32722355 GGAGAAAAGACAGCAGAGTCGGG + Intronic
1183549414 22:38472595-38472617 GGTGAAATCAGAATAAAGCCTGG + Intronic
1184902141 22:47453050-47453072 GCTGCAAAGACAACAAAATCAGG - Intergenic
949482556 3:4507920-4507942 GGTTAAATGATTACAAATTCAGG + Intronic
950848315 3:16036063-16036085 GCTAAAATCTCAACAAAGTCTGG + Intergenic
951023447 3:17805483-17805505 GGTGCAATGTCAGGAAAGTCAGG + Intronic
955777854 3:62452815-62452837 CAAGAAATGACAACAAAGGCTGG + Intronic
956241081 3:67131307-67131329 GGTGAAATCCAAATAAAGTCTGG - Intergenic
956649483 3:71490890-71490912 ATTGAAATAACAACAAACTCAGG - Intronic
957933246 3:86910361-86910383 GGAGAAATTAGAACAAAGTATGG - Intergenic
960821729 3:121740474-121740496 GGTGAAATGTGAACAACGTCTGG + Intronic
961062826 3:123846001-123846023 GGTGAAATCCAAATAAAGTCTGG - Intronic
961300347 3:125918093-125918115 GGAGAAAAGTCACCAAAGTCGGG + Intergenic
966002189 3:174963543-174963565 GATGATAGGTCAACAAAGTCTGG - Intronic
969985569 4:11206620-11206642 GATGACATGACAATAAAGTAAGG + Intergenic
970900241 4:21150435-21150457 GGTGAACTGAGATCACAGTCAGG - Intronic
972170623 4:36341395-36341417 TTTGAAATGAAAACAAAGTTAGG + Intronic
972699587 4:41481353-41481375 GGTGAAAGGAGAACTGAGTCTGG + Intronic
973943154 4:55931025-55931047 GGTGATATAACAGCAATGTCTGG - Intergenic
977964207 4:103124791-103124813 GGTAGAATGACCACAAAGCCTGG - Intronic
981181955 4:141756403-141756425 GCAGATATGACAACAAAGTAAGG - Intergenic
981536647 4:145807123-145807145 GGTGAAATTCCAACAAATTTTGG - Intronic
984817692 4:183853116-183853138 GGTGAAATGAAATCAAAGTAAGG + Intergenic
985933709 5:3078942-3078964 AGTGAAATGATGACGAAGTCAGG - Intergenic
986167425 5:5287388-5287410 GTTGAAATGACAGCAGACTCAGG - Intronic
986283400 5:6341967-6341989 GGTGAATGGACAACGAGGTCAGG - Intergenic
987227667 5:15860604-15860626 TGTGAGAAGACAACAAAGACTGG - Intronic
987370901 5:17192062-17192084 GGTGAAATGAAAGAAAAGTAAGG - Intronic
987769774 5:22286461-22286483 GGTTAAAGGACAGCAGAGTCGGG + Intronic
987939553 5:24515593-24515615 GATGAAATTTGAACAAAGTCAGG - Intronic
990949838 5:61287683-61287705 GGTGGAATGACCAAAAATTCTGG - Intergenic
993811809 5:92488847-92488869 GGTGAAATGCAAACAAAGTCTGG + Intergenic
994580354 5:101633446-101633468 AGTGATATGACAGTAAAGTCCGG - Intergenic
994713965 5:103299891-103299913 GGTGAAATTCAAATAAAGTCTGG - Intergenic
994721819 5:103389446-103389468 TGTGAAATGACACCAGAATCTGG - Intergenic
995056506 5:107765318-107765340 TCTGAAATAAAAACAAAGTCAGG + Intergenic
996183171 5:120445658-120445680 GGTGAAATGAAAACTAAGAATGG + Intergenic
997462498 5:134063228-134063250 GGTGAAATCCAAACAAAGACTGG - Intergenic
997709230 5:135989939-135989961 CGTGAATTGACAACAATTTCTGG - Intergenic
998055349 5:139071446-139071468 GGTGAAGTCACACCCAAGTCAGG - Intronic
999476928 5:151908732-151908754 TGTTAAATGAAAACAAAATCAGG + Intronic
999934265 5:156468504-156468526 GGTTAAATGACAACAGAGAAGGG + Intronic
1002619107 5:180474459-180474481 GGGGAAAGGACAAGAAAGTTTGG + Intergenic
1003883165 6:10496771-10496793 AGTGAAATCAGAATAAAGTCTGG - Intronic
1005860710 6:29897717-29897739 GGTGGAACAAAAACAAAGTCTGG - Intergenic
1006527005 6:34615080-34615102 GGTGAAATCCAAATAAAGTCTGG + Intronic
1007232066 6:40355419-40355441 TGTGAAAGAACAAGAAAGTCAGG - Intergenic
1007998610 6:46335239-46335261 GGAGAAAGGACATCAAATTCTGG + Intronic
1011090012 6:83586887-83586909 AGTGAAATGATAAAAAATTCTGG - Intronic
1012291000 6:97455283-97455305 GGTGAAAGCCAAACAAAGTCTGG + Intergenic
1012949917 6:105506765-105506787 GGTGAAAAGACACCAAAGGTGGG + Intergenic
1013321028 6:108989697-108989719 GGTCAAATGAGAAAAAAGGCAGG + Intronic
1014265885 6:119277378-119277400 AGTGATATCACAAGAAAGTCTGG + Intronic
1020928710 7:14366471-14366493 GGTCAAATGCCAACACATTCAGG - Intronic
1021894106 7:25217845-25217867 GGTGAAATGATAAAAGAGTTCGG + Intergenic
1022121641 7:27314261-27314283 GGTGAAAGGACAGGAAAGTCAGG - Intergenic
1023850731 7:44148853-44148875 GGAGAATTCACATCAAAGTCTGG - Intronic
1024584140 7:50826585-50826607 GGTGAAATACAAAAAAAGTCTGG - Intergenic
1024646437 7:51374943-51374965 GGTGAAATCCCAACAAAGTCTGG - Intergenic
1028521120 7:91732063-91732085 GCTGAAAATACAACAAACTCCGG - Intronic
1029025192 7:97409635-97409657 GGTGAAATGTCTACAAATTGTGG + Intergenic
1030598291 7:111564441-111564463 GGTGAATAAACAACAAAGACAGG + Intergenic
1031130045 7:117822428-117822450 TATGAAATGACAAAAAAGGCAGG - Intronic
1036057818 8:5279115-5279137 GCAGAAATGGCAAAAAAGTCAGG + Intergenic
1036105625 8:5835460-5835482 GGTAAAATGTAAATAAAGTCTGG - Intergenic
1036849620 8:12192582-12192604 GGAGAACTGTCACCAAAGTCAGG - Intronic
1036870983 8:12434855-12434877 GGAGAAGTGTCACCAAAGTCAGG - Intronic
1038322195 8:26537801-26537823 GGTGAAATTTGAACAAAATCTGG - Intronic
1038418787 8:27418729-27418751 GTTAAAATGGCACCAAAGTCCGG + Intronic
1038527641 8:28290432-28290454 GCTGAAATCAAAATAAAGTCTGG + Intergenic
1039016968 8:33160476-33160498 GTTGAAATGACAAAAAACTTGGG - Intergenic
1041367724 8:57126536-57126558 GGTGAAGTTTGAACAAAGTCTGG + Intergenic
1041764429 8:61403530-61403552 GGTGGGAAGACAACAAATTCCGG + Intronic
1042150804 8:65781449-65781471 GGTGTGATGAGAACAGAGTCAGG + Intronic
1043490764 8:80746877-80746899 GGTGAAATGAAAATATAGTTGGG + Intronic
1046866593 8:119157825-119157847 TGTGATATGACAACCAAGTATGG + Intergenic
1047467272 8:125129179-125129201 CGTGAAATGACAAGAAGGCCCGG + Intronic
1047857079 8:128922443-128922465 GGTGAATTGAAAGCCAAGTCTGG + Intergenic
1047857413 8:128926686-128926708 GGAGAAATCACAATAAAGACTGG - Intergenic
1051631766 9:19147356-19147378 GGTGGGAGGACCACAAAGTCAGG + Intronic
1051734972 9:20188672-20188694 GGGGAAATGACAACAGAAGCAGG + Intergenic
1051961585 9:22770937-22770959 GGTGAAATGACTAAAAACTGGGG - Intergenic
1056462755 9:86824059-86824081 GGGGAAATCAGAATAAAGTCTGG + Intergenic
1056757473 9:89390951-89390973 GGTGAAATTCCAACAGACTCTGG + Intronic
1057363435 9:94396528-94396550 AGTAAAATGAAAACAAAGTGGGG + Intronic
1057659900 9:96991570-96991592 AGTAAAATGAAAACAAAGTGGGG - Intronic
1057909456 9:99006424-99006446 TGTGCAATGACATCAAAGGCCGG - Intronic
1060433752 9:123574894-123574916 GATGAAATCACAATAAAGTCTGG - Intronic
1185507484 X:641781-641803 GGTGAAAAGTCCACACAGTCAGG + Intronic
1188529019 X:31117521-31117543 GGTGGAATGAATACAAAGGCAGG - Intronic
1189173139 X:38928757-38928779 GGTGAAATGACACCAAAAAGTGG - Intergenic
1192338811 X:70244643-70244665 GGTGAAATTTGAATAAAGTCTGG + Intergenic
1192358458 X:70424151-70424173 GGTGAAAGTACAACAAACGCAGG - Intronic
1192626246 X:72731668-72731690 GGTGAAATCCAAATAAAGTCTGG + Intergenic
1196285625 X:113876401-113876423 GGTGAAATCCAAATAAAGTCTGG - Intergenic
1196435186 X:115667769-115667791 GGTGATATGTCAAATAAGTCGGG + Intergenic
1196487283 X:116227404-116227426 GGTGAAATGAAAACAATGCATGG - Intergenic
1196636054 X:118003968-118003990 GGTGAAATGCAAACAAAATGAGG + Intronic
1198452658 X:136783401-136783423 GGTAAAATGTCAACAAAGCAAGG + Intergenic
1198638277 X:138724832-138724854 GGTGAAATCCAAATAAAGTCTGG + Intronic