ID: 1102934165

View in Genome Browser
Species Human (GRCh38)
Location 12:116882754-116882776
Sequence ACCTTTAGGCAGCAGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102934165_1102934170 28 Left 1102934165 12:116882754-116882776 CCTTGCCTCTGCTGCCTAAAGGT 0: 1
1: 0
2: 0
3: 26
4: 269
Right 1102934170 12:116882805-116882827 ACTATAATATTTCAAAGATGAGG 0: 1
1: 0
2: 1
3: 33
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102934165 Original CRISPR ACCTTTAGGCAGCAGAGGCA AGG (reversed) Intergenic
900227981 1:1541508-1541530 CGCTTCAGGCAGCACAGGCACGG + Intergenic
900776073 1:4586380-4586402 ACGTTTAGACAGCAGAGCAAAGG + Intergenic
901637213 1:10675958-10675980 AACTTGAGGGAGAAGAGGCAAGG - Intronic
903375689 1:22864401-22864423 CATTTTAGGCAGCAGAAGCAGGG + Intronic
904264046 1:29307553-29307575 ACCCTTAAGCAGCAGAAACAGGG - Intronic
906315652 1:44784984-44785006 ACCTATAGGTGGCAGAGACAGGG + Exonic
906728764 1:48063608-48063630 TCCATCAGGCAGCAGAGGGAGGG - Intergenic
909051455 1:70773525-70773547 ACTCTGAGGCAGCAGAGGAAGGG + Intergenic
911225343 1:95298339-95298361 ACCAGGAGGCAGCATAGGCAGGG - Intergenic
912012981 1:104994663-104994685 ACCTCTAAGCAGCAAGGGCATGG - Intergenic
912944466 1:114073499-114073521 ACCTTTGGACAGGAGAGGAATGG + Intergenic
913410247 1:118542902-118542924 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
915945225 1:160145143-160145165 ACATTTGAGCAGCAGGGGCAAGG + Intergenic
916261229 1:162844379-162844401 GCCCTTAGGGAGCAGAAGCAGGG - Intronic
918003801 1:180523295-180523317 ACCAGTAGCCAGAAGAGGCAAGG + Intergenic
921381983 1:214533465-214533487 ACATTAAGCCAGCAGAAGCAGGG + Intronic
921584404 1:216930487-216930509 ACCCATGGGCAGCAGAGGCAAGG - Intronic
923589409 1:235305711-235305733 CACTTTAGGAGGCAGAGGCAGGG + Intronic
1064839391 10:19573487-19573509 AACTTTAGGCAGGAAAAGCAGGG + Intronic
1065224891 10:23533690-23533712 AACTTTGGGAGGCAGAGGCAGGG + Intergenic
1065775266 10:29113846-29113868 CCCTCTAGGCAGCAGAAACAAGG - Intergenic
1066379308 10:34887923-34887945 CCAGTTAGGCAGCTGAGGCAGGG - Intergenic
1068173647 10:53427677-53427699 GCCTTTAGGCAGCAGGAACAGGG - Intergenic
1068886677 10:62104975-62104997 ACCTTTAGGGAGGAGAGCAAAGG + Intergenic
1069548366 10:69344871-69344893 TGCTGTAGGCAGCAGAGGGAGGG + Intronic
1070571251 10:77640462-77640484 AGCTTCAATCAGCAGAGGCAGGG - Intergenic
1071230589 10:83580718-83580740 TCCTGAAGGCAGCAGGGGCAAGG + Intergenic
1071513989 10:86285006-86285028 ACCTGTGGGCTGGAGAGGCATGG - Intronic
1077229835 11:1453793-1453815 ACCTCCAGGCAGCAACGGCAGGG + Intronic
1079091091 11:17480749-17480771 GCCTCTAGACAACAGAGGCAGGG + Intergenic
1079360717 11:19768182-19768204 TCCTTGAGAAAGCAGAGGCAGGG + Intronic
1083553750 11:63609774-63609796 ACCTTTGGGCTGCTGAGGCTGGG - Intronic
1084649311 11:70479411-70479433 ACCGTGAGGCAGCAGGCGCAGGG + Intronic
1086518011 11:87636469-87636491 TCATGTAGTCAGCAGAGGCATGG + Intergenic
1089359752 11:117877831-117877853 AACTGAGGGCAGCAGAGGCAGGG - Intergenic
1089395566 11:118134612-118134634 AGCTTTAAGCATCAGAGTCAAGG + Exonic
1090033520 11:123228445-123228467 GCCCTTAGGCAGCGGAGGGATGG + Intergenic
1090707569 11:129352998-129353020 ACCCATAGGCAGCATATGCAGGG - Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093240047 12:16659110-16659132 ACTTTGAGGCAGCAGAGGAAGGG + Intergenic
1095178806 12:39123330-39123352 ATATTCAGGAAGCAGAGGCAAGG - Intergenic
1095931994 12:47636742-47636764 TCCTGGAGGCACCAGAGGCATGG + Intergenic
1095980555 12:47972094-47972116 ACCTGGAGGAAGCAGGGGCAGGG + Intergenic
1097950132 12:65418706-65418728 ACATTAAGCCAGCAGAAGCAGGG - Intronic
1098828242 12:75326989-75327011 TCCTGAAGGCAGAAGAGGCAAGG + Intronic
1099667683 12:85653239-85653261 ACATGGAGGCAGCAGAGGAAGGG + Intergenic
1100983694 12:100185295-100185317 CCCTTTAGGAAGCAGAGCCAAGG - Intergenic
1101122667 12:101599176-101599198 AACTTTAGGAAGCAAAGGCATGG + Intronic
1101445641 12:104735084-104735106 AACTTCAGGGAGCAGAGGTAGGG + Intronic
1101713006 12:107286188-107286210 ACTTTTAGACACCAGAGGCTGGG - Intergenic
1102145003 12:110648459-110648481 GACTTGAAGCAGCAGAGGCAAGG + Intronic
1102167149 12:110815650-110815672 GCCTTCATGCTGCAGAGGCAGGG - Intergenic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1103025865 12:117573450-117573472 ACCAGTTGGCAGCAGAGTCAGGG + Intronic
1103725563 12:122995868-122995890 TCCACTATGCAGCAGAGGCAGGG + Intronic
1103849457 12:123922446-123922468 ACCTTTAGGAAGCAGAGGGTGGG + Intronic
1104336061 12:127896644-127896666 ACGTCTAGCCAGCAGAGGCCAGG + Intergenic
1104340678 12:127945793-127945815 ACCTGGAGGCAGCACAGGCAAGG + Intergenic
1105365499 13:19760605-19760627 AGCTTTGGGAAGCAGAGGCGGGG + Intronic
1111581781 13:90231676-90231698 ACATTAAGCCAGCAGACGCAGGG + Intergenic
1113226987 13:108169571-108169593 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1113604542 13:111595975-111595997 ACCTTTAGGAAGCAGGAGCCAGG + Intronic
1113830976 13:113295878-113295900 ATCCTTAGGCAGCAGATGCAGGG + Intergenic
1113852132 13:113423853-113423875 AGCCTGAGGCAGCAGTGGCAAGG + Intronic
1114134741 14:19834710-19834732 TCCTGCTGGCAGCAGAGGCAGGG - Intergenic
1117465004 14:55984429-55984451 ACCTCTAGGAAGAAGAGCCAAGG + Intergenic
1118348520 14:64957344-64957366 GCCTTTATTCAGCAGAGGGAAGG - Intronic
1118756462 14:68848264-68848286 ACCTATAGGAAGCTGAGGCTAGG + Intergenic
1118806924 14:69246007-69246029 ATCTTTAGGAAGCAGAAGTAGGG - Intergenic
1118966958 14:70595822-70595844 ACATTAAGCCAGCAGAAGCAGGG + Intronic
1119224782 14:72936587-72936609 ACATTTGGGCTGCAGGGGCAGGG + Intronic
1119856527 14:77905132-77905154 AGATTTAAGCAGCAGAAGCAAGG + Intronic
1123577792 15:21690284-21690306 TCCTGCTGGCAGCAGAGGCAGGG - Intergenic
1123614416 15:22132765-22132787 TCCTGCTGGCAGCAGAGGCAGGG - Intergenic
1126204861 15:46034239-46034261 TCCTTTGGACAGTAGAGGCAGGG + Intergenic
1128259815 15:66225208-66225230 CCCATTAGGGAGCAGAGCCAAGG + Intronic
1128756280 15:70185983-70186005 TCCATTAGGCAGGAGAGGCCAGG + Intergenic
1128897224 15:71386171-71386193 ACATTTGGGCAGCAGAAACAAGG - Intronic
1130807176 15:87335850-87335872 ACCTTTAGGGAGCATAGATAAGG + Intergenic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131179037 15:90227883-90227905 CCCTGTAGGCAGAAAAGGCATGG - Exonic
1131525755 15:93151139-93151161 CCCTTTCGGCAGCAGAGTCATGG + Intergenic
1131778364 15:95827008-95827030 ACCTATAGGCTGCAGAAGGAAGG + Intergenic
1202986661 15_KI270727v1_random:424529-424551 TCCTGCTGGCAGCAGAGGCAGGG - Intergenic
1132634119 16:934749-934771 ACCCTCAGACAGCAGAGGCGTGG + Intronic
1135591333 16:23706956-23706978 AGGTTCAGCCAGCAGAGGCAGGG - Intronic
1135992101 16:27224476-27224498 AGCCTGAGGCAGCAGTGGCAGGG + Intergenic
1136069772 16:27780845-27780867 CCCTGGAGGCAGCAGGGGCATGG - Intergenic
1138246590 16:55471186-55471208 GCCCTTAAGGAGCAGAGGCAGGG - Intronic
1140182076 16:72729899-72729921 ACTTTAAGCCAGCAGAAGCAGGG + Intergenic
1140227025 16:73086655-73086677 AACTTTGGGAAGCTGAGGCAGGG + Intergenic
1140657409 16:77155036-77155058 ACCTTTAGCCAGCATGGGCTCGG - Intergenic
1140858076 16:78995320-78995342 ACCTGTAGGCAGGAGAGGGGAGG - Intronic
1141578856 16:84983483-84983505 AGCCTTGGGCAGCACAGGCAGGG + Intronic
1142298618 16:89243200-89243222 TCCTGTAGGCAGCAGTGGAAAGG + Intergenic
1145871318 17:28276028-28276050 ACCTTAAGCCAGCAGAAGCAGGG - Intergenic
1146132880 17:30293647-30293669 ATGTTTTGGGAGCAGAGGCAAGG + Intergenic
1148738062 17:49875867-49875889 GCCTGCAGGCAGGAGAGGCAAGG + Intergenic
1149920876 17:60658211-60658233 ACCTTTAGGCAGTATAGAGAAGG + Intronic
1151365606 17:73614342-73614364 TCCTTTAGGAAACCGAGGCAGGG - Intronic
1152164604 17:78694381-78694403 ACCTTTAGGGACCAGTGGCAAGG - Intronic
1156361760 18:36389949-36389971 CCCTTCAGGCTGCAGATGCAAGG + Intronic
1156532661 18:37833021-37833043 ACCTTTAGTCAGCAAAGGAATGG + Intergenic
1158593784 18:58799195-58799217 CACTTTAGGAAGCTGAGGCAAGG - Intergenic
1158775602 18:60575025-60575047 AGCTTTCAGCAGGAGAGGCATGG + Intergenic
1158868974 18:61665797-61665819 ACCTGTGGGCAGCTTAGGCAAGG + Intergenic
1159607046 18:70485557-70485579 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1162036593 19:7943456-7943478 ATCTTTGGGTAGCAGAGGCCAGG - Intronic
1162937243 19:13987334-13987356 ACCTTTAGGCAGGGCAGGCAGGG + Intronic
1163420984 19:17213515-17213537 ACATTTAGGCTCCAGAGGCTGGG - Intronic
1163987081 19:20963364-20963386 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1163987267 19:20965191-20965213 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1165453369 19:35897719-35897741 AATTTTCGGCAGCAGAAGCAGGG + Exonic
1168690808 19:58376162-58376184 ACCTTTGGGAAGCTGAGGCAGGG - Intronic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
925647006 2:6045546-6045568 TCTTTGAGGCAGCAGAGGAAGGG - Intergenic
929782838 2:44968463-44968485 TCCTGTAGGCACCAGAGTCACGG + Intergenic
930064339 2:47316238-47316260 ACCAGAAGCCAGCAGAGGCAAGG - Intergenic
930939460 2:56997232-56997254 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
931323344 2:61194224-61194246 CCCTTTAGACACAAGAGGCAAGG + Intronic
931543445 2:63354344-63354366 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
932731001 2:74221941-74221963 ACCTATAGGGAGCTGAGGCTGGG + Intronic
932743046 2:74306709-74306731 ACATTAAGCCAGCAGAAGCAGGG - Intronic
932749232 2:74360881-74360903 AGCTACAGGAAGCAGAGGCAGGG + Intronic
933596551 2:84288803-84288825 ACCTGAAGGCCTCAGAGGCAGGG - Intergenic
933603941 2:84361285-84361307 ACCTGGAGACAGCAAAGGCAAGG - Intergenic
934087696 2:88524348-88524370 GCTTTCAGGCAGCAGAGGCCTGG + Intergenic
934810595 2:97273346-97273368 ACTTTGAGGCAGAAGAGGAAGGG - Intergenic
934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG + Intergenic
935707243 2:105867787-105867809 ATCTTTAGGAAGCTGAAGCAGGG - Intronic
936462164 2:112721972-112721994 ACTTGTAGGCTGCAGAGGCCCGG - Exonic
936615185 2:114041128-114041150 AACTTTAGGCAGCATATGCTAGG - Intergenic
940446977 2:153787067-153787089 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
941411382 2:165160884-165160906 CACTTTGGGAAGCAGAGGCAGGG - Intronic
943548560 2:189311244-189311266 ACATTAAGCCAGCAGAAGCAGGG - Intergenic
945955265 2:216080903-216080925 AACTTTAGGACTCAGAGGCAAGG + Intronic
947369991 2:229435544-229435566 ACTTTTAGGCATCAGAGACCTGG + Intronic
948780039 2:240314109-240314131 CACTTTAGGAGGCAGAGGCAAGG + Intergenic
948831937 2:240602548-240602570 ACCTCTAAACAGCAGAGGCCAGG - Intronic
1170776900 20:19382935-19382957 ACGTTTTGGCAGCTGAGTCAGGG - Intronic
1170864000 20:20137204-20137226 ACCTTAAGGCAGCACAGCCATGG + Intronic
1172743516 20:37188277-37188299 ACCTATAGGAGGCTGAGGCAGGG - Intronic
1173052085 20:39573183-39573205 ACCTAAAGGCAGCAGGGGCCAGG + Intergenic
1174349683 20:49958026-49958048 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1175286788 20:57841868-57841890 AACTTTAGGCAGGAAAAGCAGGG + Intergenic
1175984258 20:62756070-62756092 GCATGGAGGCAGCAGAGGCAGGG + Intronic
1181235926 22:21447570-21447592 CCCCTGAGGCAGCCGAGGCAGGG - Exonic
1181589948 22:23877798-23877820 GCTTTCAGGGAGCAGAGGCAGGG - Exonic
1181638197 22:24183965-24183987 ACGCTGAGGCCGCAGAGGCAGGG - Intronic
1182115446 22:27753731-27753753 AGCTTAAGGCATCAGATGCAGGG + Intronic
1182238849 22:28898373-28898395 ACCTCCAGGAAGCACAGGCAAGG - Intronic
1183041773 22:35185213-35185235 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1183276245 22:36900068-36900090 CCCTTGAGGCTGCAGGGGCAGGG + Intergenic
1184448451 22:44568244-44568266 ACATTAAGGCAGCAGAAGCAGGG + Intergenic
1184541447 22:45128293-45128315 ACCACTCGGCAGCAGAGGCAAGG + Intergenic
949448627 3:4162443-4162465 CCCTTTACCCAGCAGTGGCAAGG + Intronic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
950143747 3:10633286-10633308 ACCTTTTGGAAGCGGAGGCAGGG - Intronic
950403228 3:12787374-12787396 ACATTAAGCCAGCAGAAGCAGGG - Intergenic
952029915 3:29129437-29129459 ACATTTAGGCAAAGGAGGCAAGG + Intergenic
952319249 3:32260224-32260246 ACATTAAGCCAGCAGAAGCAGGG + Intronic
952606640 3:35155035-35155057 ACCTGGAGGCAGCAGAGGAAGGG - Intergenic
952817494 3:37458302-37458324 TCCTTTAGGAAGCAGATGCTAGG + Intronic
952912820 3:38204948-38204970 CACTTTAGCCTGCAGAGGCACGG + Intronic
954800629 3:53185113-53185135 GAATTTAGGCAGCAGAGGGAGGG + Intronic
954842146 3:53521285-53521307 TGCTTTAGGAAGCTGAGGCAGGG - Intronic
957878677 3:86182770-86182792 GCCATTAGGCAGCAGAGGATTGG - Intergenic
959452221 3:106517785-106517807 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
961210452 3:125121082-125121104 ATCAGCAGGCAGCAGAGGCAGGG - Intronic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
961540666 3:127597253-127597275 AGCCTTAGTGAGCAGAGGCAGGG - Intronic
961718047 3:128872391-128872413 CCCTGTAGGCAGCACAGGAAAGG - Intergenic
963072049 3:141312452-141312474 AGCCTTAGGCAGCAGATGCCGGG + Intergenic
964035600 3:152192697-152192719 ACCTGGAGGCAGAAGTGGCAGGG + Intergenic
964465611 3:156988413-156988435 ACCTGCAGGCAGCTGAGTCATGG + Intronic
965544612 3:169902959-169902981 ACATTAAGCCAGCAGAAGCAAGG - Intergenic
966424946 3:179771134-179771156 ACCTAGAGGAAGCAGAGCCAAGG - Intronic
966489951 3:180516741-180516763 TCTTGTTGGCAGCAGAGGCAGGG - Intergenic
967183033 3:186922916-186922938 GGCTTTAGACAGCAGAGGCGTGG - Intergenic
968184790 3:196625144-196625166 ACCATGAGGAAGCGGAGGCACGG + Intergenic
968837436 4:2975418-2975440 ACCGTGGGGGAGCAGAGGCAGGG + Intronic
968853560 4:3101536-3101558 AGCTGTAGGGAGCATAGGCATGG + Intronic
969567011 4:7984665-7984687 ACTTTTGGCCAGGAGAGGCAGGG + Intronic
969653896 4:8485141-8485163 ACCTTGAGGCAGCACAGCCCAGG + Intronic
971400840 4:26273972-26273994 ACCCATAGGCAGCAGGGGAATGG - Intronic
971727126 4:30328171-30328193 GCCTTACAGCAGCAGAGGCAGGG + Intergenic
971931596 4:33090865-33090887 AGCTTTTGGCCTCAGAGGCAAGG + Intergenic
973731041 4:53822548-53822570 ACCTTTTTGGAGCAGAGGGAGGG - Intronic
975106122 4:70571221-70571243 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
975174167 4:71268396-71268418 ACATTGAGGGAGCAGAAGCAGGG - Intronic
975591654 4:76006486-76006508 GCTTTTAGGGAGCAGGGGCAGGG + Intronic
976510198 4:85899800-85899822 CACTTTGGGAAGCAGAGGCAAGG + Intronic
978683679 4:111414491-111414513 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
978952887 4:114582368-114582390 ACTTGGAGGCAGCAGAGGAAAGG + Intergenic
979045093 4:115852444-115852466 ACTTGGAGGCAGCAGAGGCAGGG - Intergenic
980625559 4:135371161-135371183 ACATTAAGCCAGCAGAAGCAGGG - Intergenic
981422957 4:144572213-144572235 ACATTAAGCCAGCAGAAGCAGGG - Intergenic
981606357 4:146545509-146545531 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
982083792 4:151814976-151814998 ACCTTGCGGCAGCACAGCCAAGG + Intergenic
986341519 5:6793327-6793349 CCGTTCTGGCAGCAGAGGCACGG - Intergenic
987592284 5:19945239-19945261 ACCTATAGGCAACACAAGCAGGG + Intronic
989012312 5:36886491-36886513 ACATTAAGTCAGCAGAAGCAGGG + Intronic
992800328 5:80289776-80289798 ACATTCAGCCAGCAGAAGCAGGG + Intergenic
993283033 5:85952223-85952245 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
995215453 5:109589590-109589612 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
995270910 5:110219250-110219272 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
995486370 5:112644167-112644189 ATCTTTTGGCAGCACAGGCAGGG - Intergenic
998503467 5:142653369-142653391 TCCTTCAGGCAGAAGAGGAAAGG + Intronic
999052226 5:148534854-148534876 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
999067644 5:148707819-148707841 ACCTATAGCCAGCAGAAGTAAGG + Intergenic
999713685 5:154341821-154341843 CCCTTTAGGCTGCAGGGGGATGG + Intronic
1000031739 5:157407451-157407473 ACTTGGAGGCAGCAGAGGAAGGG - Intronic
1000037728 5:157461460-157461482 ACCTTCAGGGAGCAGGGGAAGGG + Intronic
1000494512 5:161964219-161964241 AGCTATAAGCAGCAGAGACAGGG - Intergenic
1001115879 5:168939062-168939084 CCCTGTAGGCAGCAAAGGAATGG + Intronic
1001300479 5:170530051-170530073 AGCTGTAGTCAGCAGTGGCATGG - Intronic
1001448777 5:171807927-171807949 ACCTGTAGGCAGGAGACGCTGGG + Intergenic
1002857264 6:1049196-1049218 ACATTTAGGCCTCAGAGTCAAGG + Intergenic
1003231662 6:4259269-4259291 CACTTTGGGCAGCCGAGGCAGGG - Intergenic
1003248222 6:4402027-4402049 TCCTTTGGGTAGCAGAGGGAAGG - Intergenic
1006644867 6:35509155-35509177 CCCTTCAGGGAGCAGAGGCAGGG - Intronic
1007215810 6:40236214-40236236 ACTTGGAGGCAGCAAAGGCAGGG - Intergenic
1007603386 6:43097946-43097968 ACCACTGGGCAGCTGAGGCAGGG - Intronic
1008173294 6:48234990-48235012 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008211512 6:48729915-48729937 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1008691841 6:53987794-53987816 CCCTTTAGGCAGAAGTGGCTGGG - Intronic
1011242707 6:85289007-85289029 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1011392397 6:86868116-86868138 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1012251956 6:96990603-96990625 ACTTGGAGGCAGCAGAGGGAGGG + Intronic
1013426872 6:110020018-110020040 ACCTTTGGGAAGCAGAGAAAAGG + Intergenic
1013667233 6:112361421-112361443 ACATTAAGCCAGCAGAAGCAGGG - Intergenic
1013980558 6:116122416-116122438 ACCTGTGTTCAGCAGAGGCATGG - Intronic
1016415503 6:143828804-143828826 ACATTTAGTCAGCAGGGGCCTGG - Intronic
1016986161 6:149897551-149897573 ACCTCAAGGCAGCTGGGGCAGGG - Intronic
1017535927 6:155348451-155348473 ACCTGGAGGCAGCAGAGGAAGGG + Intergenic
1018963999 6:168469234-168469256 TCCTTCAGGGAGCAGTGGCAAGG - Intronic
1019171419 6:170135281-170135303 ACCCTTGGGCAGCAGAGGTGTGG - Intergenic
1021936827 7:25639311-25639333 ACCAATAAGCAGCAGAGCCAGGG - Intergenic
1022903652 7:34834901-34834923 ACCCTTAGCCAGTAAAGGCACGG + Intronic
1024789472 7:52948002-52948024 AGCTTTAGACAGAAGAGGAAAGG + Intergenic
1025986352 7:66455945-66455967 ACCCTTAGGCTGCATATGCATGG + Intergenic
1025989976 7:66490483-66490505 GCCCTTTGGAAGCAGAGGCAGGG + Intergenic
1026186871 7:68088907-68088929 ACTGTTAGGCAGCAGAACCAAGG - Intergenic
1027247166 7:76375049-76375071 ACATGTAGGCAGCAGAGGAGAGG + Intergenic
1030200842 7:106902082-106902104 ACTTGGAGGCAGCAGAGGAAGGG + Intronic
1030586680 7:111429358-111429380 ATCTTTCAGCAGAAGAGGCAAGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1033281427 7:140009344-140009366 ACCCGTAGGAAGGAGAGGCACGG - Intronic
1033344570 7:140517398-140517420 ACCTTTAGGGAGCGGGAGCAAGG - Intergenic
1035957907 8:4102870-4102892 ACCTTTAGACTGCAGAGGTAAGG - Intronic
1038590913 8:28836772-28836794 ACCATTAGGGAGCTGAGGAAGGG - Intronic
1038938255 8:32276211-32276233 ACCTGTAGTCATTAGAGGCAGGG - Intronic
1039258692 8:35747008-35747030 ACCTTTAAGTAGGGGAGGCAAGG - Intronic
1039866867 8:41512519-41512541 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1041611457 8:59854737-59854759 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1047650444 8:126914518-126914540 ACCTCTAGGCTTCAGAGGGATGG - Intergenic
1047868488 8:129056122-129056144 AGCTGAAGGCAGCAGAGGTAAGG - Intergenic
1049708368 8:144052942-144052964 GCCTCTAGGCGGCAGGGGCACGG - Intronic
1051184388 9:14443045-14443067 ACATATAGGCAGAAGAGTCATGG - Intergenic
1052626248 9:30980840-30980862 ACCTGGAAGCAGCAGAGGAAGGG - Intergenic
1055053345 9:72001134-72001156 ACCCTTAGGAAGCAGTGACAAGG + Intergenic
1057739711 9:97700728-97700750 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1058928815 9:109698153-109698175 ACCTTTTTGCAGCTGAGACATGG + Intronic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1060348717 9:122838821-122838843 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1060875564 9:127081333-127081355 ATATTCAGGAAGCAGAGGCAAGG - Intronic
1061419465 9:130465568-130465590 ACCTGTGGGCAGCACAGGCCGGG + Intronic
1061840037 9:133353374-133353396 ACCTTGAGGGAGTGGAGGCAGGG - Intronic
1062013692 9:134280628-134280650 ATCTTTGGGCAGCAGGAGCAAGG + Intergenic
1062180285 9:135187728-135187750 ACATGTGGGCAGCACAGGCATGG - Intergenic
1185705635 X:2264370-2264392 ACCTCTACCCAGCAGATGCAGGG + Intronic
1186869918 X:13760866-13760888 ACCAACAGGCAGCAAAGGCAAGG - Intronic
1188108396 X:26168659-26168681 ACCCCTGGGCAGCAGTGGCATGG - Intergenic
1191033109 X:55996833-55996855 ATCTGTTGGCAGCAGTGGCATGG + Intergenic
1193006010 X:76618593-76618615 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193299111 X:79867976-79867998 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1193497861 X:82236652-82236674 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1193607307 X:83584052-83584074 ACTTAAAGGCAGCAGAGGAAGGG - Intergenic
1193714864 X:84926533-84926555 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1194378482 X:93165380-93165402 ACCCCCTGGCAGCAGAGGCATGG + Intergenic
1194403813 X:93468961-93468983 GCTTGTAGGCAGCAGAGGCAGGG - Intergenic
1194405042 X:93486229-93486251 ATCTTTAGGCAACAGAGGGTGGG + Intergenic
1194593906 X:95835395-95835417 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1194948116 X:100092241-100092263 ACTTGGAGGCAGCAGAGGAAGGG - Intergenic
1195357144 X:104049408-104049430 ACTTTTACCCGGCAGAGGCAGGG + Intergenic
1195636056 X:107117472-107117494 GCCTTTTGGAGGCAGAGGCAAGG + Intronic
1195665835 X:107429459-107429481 ACATTAAGCCAGCAGAAGCAGGG + Intergenic
1195856441 X:109337892-109337914 ACTTGGAGGCAGCAGAGGAAGGG + Intergenic
1196241288 X:113345991-113346013 ATCTGGAGGCAGCAGAGGAAAGG + Intergenic
1196915943 X:120535082-120535104 CACTTTAGGAAGCGGAGGCAGGG + Intronic
1197520291 X:127489538-127489560 ACCTGAAGGCAGCAGAGCAATGG + Intergenic
1197617999 X:128715784-128715806 ACATTGAGCCAGCAGAAGCAGGG + Intergenic
1197706622 X:129639026-129639048 TCTTTTAGGAAGCAGAAGCAGGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1199635706 X:149809681-149809703 CACTTTAGGAGGCAGAGGCACGG + Intergenic
1200745128 Y:6897525-6897547 AACTTTGGGAAGCCGAGGCAGGG - Intergenic