ID: 1102934858

View in Genome Browser
Species Human (GRCh38)
Location 12:116887817-116887839
Sequence TACAAGGACGTCCCTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102934858_1102934861 3 Left 1102934858 12:116887817-116887839 CCTTCTCCAGGGACGTCCTTGTA No data
Right 1102934861 12:116887843-116887865 CATTTGATACCTCTCCCCTGAGG No data
1102934858_1102934866 26 Left 1102934858 12:116887817-116887839 CCTTCTCCAGGGACGTCCTTGTA No data
Right 1102934866 12:116887866-116887888 ATCTTGTTGTTGTAAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102934858 Original CRISPR TACAAGGACGTCCCTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr