ID: 1102940981

View in Genome Browser
Species Human (GRCh38)
Location 12:116941504-116941526
Sequence TAGCAGAAGCATAATTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102940981 Original CRISPR TAGCAGAAGCATAATTAAGG AGG Intronic
902792648 1:18779419-18779441 CAGCAGAAGCAAAACCAAGGTGG + Intergenic
906985015 1:50673913-50673935 TAGCAGAAGCAGAATTCAAAAGG + Intronic
907686571 1:56617541-56617563 AGGCAGAAGCCTAATTAAAGTGG + Intronic
907777103 1:57527143-57527165 CAGTAGAAGCATAAATAAAGTGG - Intronic
908872080 1:68624797-68624819 TAGGAGAAACATTTTTAAGGTGG + Intergenic
909744650 1:79078744-79078766 TACAAGAAGCATGACTAAGGAGG - Intergenic
909798280 1:79771995-79772017 TCACAGAAGTTTAATTAAGGAGG - Intergenic
910492203 1:87784963-87784985 AGGCAGAAGCCAAATTAAGGAGG - Intergenic
910928501 1:92420064-92420086 AAGCATAAGCAAAATCAAGGAGG + Intergenic
911306667 1:96240659-96240681 TTGCAGAAGCATAAGTTAGATGG + Intergenic
911881858 1:103250200-103250222 TGGCAGGAGCATAATTAAGTAGG + Intergenic
912875157 1:113350244-113350266 TAGCAGAAGGGAAAATAAGGAGG + Intergenic
913365488 1:118033444-118033466 TAGAAGAGGCATAATTTGGGAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916455255 1:164964582-164964604 GAGCAGAAGCATTATCATGGTGG - Intergenic
916468230 1:165093550-165093572 TAGCAGAGGCAGGATGAAGGGGG - Intergenic
916622954 1:166521056-166521078 TTGCAGAAGGATATTTAAGCAGG - Intergenic
919175401 1:194012403-194012425 TAGCACATTCATATTTAAGGAGG + Intergenic
919867827 1:201795636-201795658 TGACAGAAGCATAATTATAGTGG - Intronic
922087355 1:222363560-222363582 TGGCAAAAGCCTAATTAGGGTGG + Intergenic
923196378 1:231672362-231672384 TAGTGGTAGCATAATTTAGGAGG - Intronic
923647840 1:235842132-235842154 CAGCAGAAGCATAAGTGAAGGGG + Intronic
924856142 1:247876897-247876919 GAGGAGAAACAGAATTAAGGAGG - Exonic
1065485756 10:26235172-26235194 TAGCACAAGAATAACTAACGGGG - Intronic
1065864832 10:29905505-29905527 TATCAGCACCATTATTAAGGAGG + Intergenic
1066523800 10:36253239-36253261 GGGCAGAAGCATAAGTTAGGAGG - Intergenic
1068611642 10:59066894-59066916 TAGCACAAGCCCAATGAAGGTGG + Intergenic
1069804422 10:71109708-71109730 TAGCAAAAGCATTAGTAAGAGGG - Intergenic
1070051630 10:72895428-72895450 TGCCAGAAGCATGATAAAGGGGG + Intronic
1073276315 10:102314718-102314740 TAGCAGAAGCATAATTTCTTTGG + Intronic
1076852580 10:133100259-133100281 TACCAGAGGAATGATTAAGGAGG - Intronic
1078013297 11:7590912-7590934 TAGGAGAAGCATAATTATTCCGG - Intronic
1078025193 11:7688348-7688370 TAGCAGTAGCACATTTGAGGAGG - Intergenic
1078510613 11:11981645-11981667 AACCAGAAGCATAATCATGGTGG + Intronic
1085824552 11:79830824-79830846 GAGCAGAAGCATTGTTATGGTGG - Intergenic
1085920550 11:80950174-80950196 AATCAAAACCATAATTAAGGGGG - Intergenic
1087555871 11:99720302-99720324 TAGCAGCACCATAATCAAGTAGG + Intronic
1089802683 11:121048579-121048601 TAGCAGAAACAGAATAAAGCTGG - Intronic
1095257847 12:40061181-40061203 AAGCAGCAGCATAAATAAGCTGG + Intronic
1095434499 12:42172410-42172432 CAGCTGAAGCATATTTAAGAAGG - Intronic
1095506491 12:42904503-42904525 TAGCATTAGCAAAATTAATGTGG - Intergenic
1098295357 12:68998662-68998684 TAGCAGAAGTATAATTACTAAGG - Intergenic
1098801060 12:74958769-74958791 TAGAAGAACCATAACTAAGGAGG + Intergenic
1099945845 12:89243537-89243559 TAGCAAAAGCAATACTAAGGGGG - Intergenic
1100415436 12:94368639-94368661 TAGCAGAAGTATAAATAACATGG + Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1102940981 12:116941504-116941526 TAGCAGAAGCATAATTAAGGAGG + Intronic
1104787965 12:131462012-131462034 TAGCAGAAGCATTGTTGTGGTGG + Intergenic
1105515486 13:21085991-21086013 TAGCAAAAGCAGTACTAAGGGGG + Intergenic
1105532973 13:21236956-21236978 TAGCAGAAGTAGACTTAAAGGGG + Intergenic
1109357560 13:61250088-61250110 TAACAGAAGAAAAACTAAGGTGG + Intergenic
1109489130 13:63072049-63072071 GAGCAGAAGCATTGTTATGGTGG + Intergenic
1110095451 13:71513323-71513345 TAGCAGAAACCAAATTAATGAGG + Intronic
1110350237 13:74498590-74498612 TAACATAAGCATAATTTGGGGGG + Intergenic
1115003642 14:28453464-28453486 TAGCAAAAGCATGTTTAAGAGGG - Intergenic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1117112243 14:52470110-52470132 AAGCAGAAGAATATTTAAGTGGG - Exonic
1117129241 14:52668001-52668023 TATTAGAAGCATAAATTAGGGGG + Intronic
1117184284 14:53224192-53224214 CAGCAAAAGCAGTATTAAGGGGG - Intergenic
1120388519 14:83876299-83876321 TGGCAGAAGCAGAAGCAAGGTGG - Intergenic
1124378453 15:29143681-29143703 TAAAGGGAGCATAATTAAGGAGG - Intronic
1125406450 15:39357037-39357059 TAGCAGAAGAAAAATTAATTAGG + Intergenic
1126552225 15:49945039-49945061 TAGCAAAAGCAGTACTAAGGAGG + Intronic
1126944034 15:53798063-53798085 TAGCAAAAGCAGAACTAAGAAGG + Intergenic
1128267340 15:66278497-66278519 CAGCAGAAGCATAATAATGCTGG + Intergenic
1133059108 16:3163005-3163027 TAGCTGAAGCATGTTTATGGTGG + Intergenic
1143791607 17:9300446-9300468 TAGCTGAAGCAAAATAAAAGGGG - Intronic
1145807932 17:27747735-27747757 TAGCACAAGCCTGATTAAGTGGG - Intergenic
1146566314 17:33916063-33916085 TAGCATAAGCAAAGTCAAGGAGG - Intronic
1148399568 17:47344035-47344057 CACCAGAAGCATAATTAATGAGG + Intronic
1150731947 17:67703385-67703407 TAGCAGAAAAAAAATTGAGGTGG - Intergenic
1153389766 18:4542337-4542359 TACCAGAAGCTTAACTAAGTTGG - Intergenic
1153665673 18:7365973-7365995 TAGCAAAAGTATAATAAATGTGG - Intergenic
1155102319 18:22623820-22623842 AAGCAGAAAAATAATTAAAGAGG + Intergenic
1155455085 18:26003542-26003564 TAGAAGGAGCATTGTTAAGGTGG + Intergenic
1156565180 18:38180191-38180213 TAGAAAAAGCATAATTAGGCCGG - Intergenic
1156782534 18:40868090-40868112 AAGCAGAACCATAGATAAGGAGG - Intergenic
1157344059 18:46807551-46807573 TAGCAAAAACATAAATTAGGTGG - Intergenic
1159297132 18:66507148-66507170 TAGTAAAAGCATAATTTTGGGGG - Intronic
1159987403 18:74859547-74859569 AAGTAGAAAGATAATTAAGGAGG + Intronic
1160105418 18:75970132-75970154 TAGCAGAATAATAAATAAGAAGG + Intergenic
1163614665 19:18319690-18319712 TAGCAGAAGCAAAGGTCAGGTGG - Intronic
927266420 2:21157574-21157596 GAGCAGAAGCATTGTTAGGGTGG - Intergenic
927898804 2:26803939-26803961 TACCAAAGGCATAATTAATGAGG - Intergenic
928196515 2:29220277-29220299 TGGCAGGAGCAGAATGAAGGGGG - Intronic
930473046 2:51845174-51845196 TAGAAGGAGTATAATTAAGATGG - Intergenic
932839030 2:75064446-75064468 GGGCAGAAGCCTAATTTAGGTGG + Intronic
936094308 2:109520262-109520284 GAGCAGAAAGATAATAAAGGTGG + Intergenic
939058354 2:137390316-137390338 TAGCTGAAACATAATCAAGAAGG - Intronic
940454277 2:153875377-153875399 TAGCAAAGACATAATGAAGGTGG + Intronic
940487576 2:154315482-154315504 TATCAGAAGCACTATTAATGTGG + Intronic
941269817 2:163411169-163411191 TAACAGATGAATAATTAAGGTGG - Intergenic
943346854 2:186748694-186748716 TAACAGAAGCGTAATTCAGCAGG - Intronic
944110041 2:196122175-196122197 TAGCATGAGCATAATTAAGATGG - Intergenic
944346997 2:198680357-198680379 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
944906641 2:204268527-204268549 TAGCAGAACCATTAGTAAGTTGG - Intergenic
945010167 2:205452786-205452808 TAGCTCATGCATAATAAAGGAGG - Intronic
945071712 2:205996281-205996303 TAGAAGAGACAGAATTAAGGGGG + Exonic
945345398 2:208708010-208708032 GAGGAGAAGTATAATTGAGGAGG - Intronic
947042920 2:225944436-225944458 TAGCTGAAAAATAATCAAGGTGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175644846 20:60662433-60662455 TGGCAGAAGCAGAGTTAAAGGGG - Intergenic
1178550802 21:33537603-33537625 TAGGAGAGATATAATTAAGGAGG + Intronic
1182920436 22:34074294-34074316 TAGCAGAAGTAGAAATAATGTGG + Intergenic
1184003883 22:41694847-41694869 TGGGAGAAGCATGATCAAGGTGG + Exonic
949575490 3:5335051-5335073 TAGCACAAACAAAATTAAGCAGG + Intergenic
952086347 3:29826380-29826402 TGGAAGAGGCATAATTAATGTGG - Intronic
953087608 3:39686235-39686257 TAGCAGAAGTATTACTAAGAGGG + Intergenic
953896072 3:46802946-46802968 TAGCACATGCATAAATATGGAGG - Intronic
958028785 3:88081929-88081951 TAACATAAGCATACTGAAGGGGG + Intronic
959920741 3:111865632-111865654 TAGCAGAACCAGAACTAAGATGG + Intronic
963890306 3:150628156-150628178 TAGCAGATGCAAGATTATGGGGG + Exonic
965230832 3:166050559-166050581 CAACAGAAGCATAATTAGAGTGG - Intergenic
965864816 3:173193710-173193732 TGGCTTAAGCATAATTAAGTTGG - Intergenic
966103573 3:176307516-176307538 TACCAGAAGTATCAGTAAGGGGG + Intergenic
967901490 3:194458081-194458103 TAAAATAAGCATAATTAAGGCGG - Intronic
969875954 4:10135689-10135711 TAGGAGAAGCATTCTCAAGGTGG + Intergenic
970154485 4:13127911-13127933 AAGCTGCAGCTTAATTAAGGGGG + Intergenic
970924074 4:21430083-21430105 TAGCATTAGCAGAATTAATGTGG + Intronic
972410747 4:38791920-38791942 TGGAAGAAGCAAAATTCAGGTGG + Intronic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
974745729 4:66073162-66073184 TAGCCGAAGCATATTTAAGAGGG - Intergenic
976102789 4:81583216-81583238 CAGCAGAAGCATAATACAGTTGG + Intronic
977915129 4:102583737-102583759 TAGGAGAATAATAATTAAGGTGG - Intronic
978284983 4:107066412-107066434 AAGCAGAAACATATTTAATGTGG - Intronic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
978661669 4:111134798-111134820 TAGCAAAAGCAGTACTAAGGGGG - Intergenic
982143750 4:152359089-152359111 TAGTAGAAGCATAGTTAATATGG - Intronic
982243342 4:153322841-153322863 CAGAAGAAGCATAAAAAAGGGGG - Intronic
982982928 4:162164126-162164148 TAGCAGAAGCCCAGTCAAGGGGG - Intergenic
983116426 4:163822700-163822722 TAGCATAAAGATAAATAAGGTGG - Intronic
983500729 4:168496205-168496227 TAGCAGAATCAAATATAAGGGGG - Intronic
984557423 4:181231628-181231650 TAACAGAAACAAAATTACGGAGG - Intergenic
985482474 5:124003-124025 CAGCAAAAGCAGCATTAAGGGGG - Intergenic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986113474 5:4745330-4745352 TAGCAAAAGCAGTATTAAGAGGG - Intergenic
988722779 5:33894631-33894653 AAGCAGAAGCAAAGTTGAGGAGG - Intergenic
988729472 5:33956603-33956625 GAGCAGAAGCATTGTTATGGTGG - Intronic
991113109 5:62924042-62924064 TAACAGAAGCTTATTGAAGGTGG + Intergenic
991149769 5:63353793-63353815 TTGGGGAAACATAATTAAGGAGG + Intergenic
991186056 5:63808994-63809016 CAGCCCAAGCAAAATTAAGGTGG - Intergenic
994696349 5:103077221-103077243 TAGCTAAAGCAGTATTAAGGGGG - Intergenic
995411532 5:111862810-111862832 TAGCAGAAGAAAAAGTCAGGTGG + Intronic
995606800 5:113865735-113865757 TAATATTAGCATAATTAAGGAGG + Intergenic
998110419 5:139497754-139497776 TAGAAGTATCATAATAAAGGTGG + Intergenic
998940468 5:147276679-147276701 TAGCATAAGCTTAATGAGGGTGG - Intronic
1000075607 5:157782413-157782435 GAGCAGAGGCCTAATTTAGGTGG - Intergenic
1000392241 5:160735981-160736003 TAGCAAAAGCATTACTAAGAGGG + Intronic
1000650986 5:163818628-163818650 TAGCAAAAGCATTACTAAGAGGG - Intergenic
1002770517 6:286939-286961 AGGCAGAAGCATCTTTAAGGAGG + Intergenic
1003389280 6:5699269-5699291 TAGCAGAAGTAGACTTAAAGGGG - Intronic
1004158501 6:13192253-13192275 AAGAAAAAGCATCATTAAGGAGG + Intronic
1008456343 6:51715319-51715341 AGGAAGAAGCATAATGAAGGAGG - Intronic
1010320867 6:74508179-74508201 CAGCAAAAGCACATTTAAGGTGG + Intergenic
1010734078 6:79423153-79423175 TAGCAGAAGAATATTAAATGTGG - Intergenic
1013579347 6:111517704-111517726 TAGCATATGCATAATAAAGATGG + Intergenic
1014233430 6:118929648-118929670 TTGCAAAAGGATTATTAAGGGGG - Intronic
1014262901 6:119240271-119240293 TAGCATATGAATAATTAAAGTGG - Intronic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1020457045 7:8385657-8385679 TAGGAGAGGCATAAATGAGGAGG - Intergenic
1021013019 7:15495129-15495151 TAGCAAAAGCATCATGATGGGGG - Intronic
1030690056 7:112523177-112523199 TAGAAATAGCATAATTGAGGGGG - Intergenic
1031557054 7:123190465-123190487 GAGTACAAGCATAAGTAAGGGGG + Intronic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1037476494 8:19262875-19262897 TAGAAGATGCAGAATGAAGGAGG - Intergenic
1039557916 8:38490001-38490023 ATGCAGAAGATTAATTAAGGAGG + Intergenic
1039934339 8:42027927-42027949 TAGCAAAAGCAGAGTTAAGAGGG - Intronic
1043772361 8:84221123-84221145 TAGCTGAAGCAAAACTAAGGTGG - Intronic
1045107255 8:98904858-98904880 TAGCAGAAGTAGAGTTGAGGTGG + Intronic
1045628754 8:104089686-104089708 TAGCAGAATCATCATTAAACTGG + Intronic
1046274585 8:111940702-111940724 AAGCAAAACCATAGTTAAGGAGG + Intergenic
1046379240 8:113432389-113432411 TTGCAGAATAATAATGAAGGAGG - Intronic
1047910407 8:129522032-129522054 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
1048715475 8:137264024-137264046 AAGCAGAAGCTAAATTATGGAGG + Intergenic
1051325456 9:15962328-15962350 AACCAGAAGCATAGTTAAGTAGG - Intronic
1051546148 9:18278044-18278066 TAGGGGAAGAATAATTAAAGTGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1058794046 9:108480246-108480268 AAGCAGAACCATCATTAAGTTGG + Intergenic
1187628886 X:21146071-21146093 TTCCAGAAGCATCAGTAAGGCGG - Intergenic
1187909640 X:24099216-24099238 TAGCTGAAGCAGTATTAAGAGGG - Intergenic
1189150216 X:38699044-38699066 GAGCATAAGCATAATGAAGGAGG + Intergenic
1190596183 X:52054096-52054118 TTGCAGAGGAATAATTAAGTTGG - Exonic
1190612641 X:52199977-52199999 TTGCAGAGGAATAATTAAGTTGG + Exonic
1193428585 X:81371682-81371704 TAATAGAAGCAAAATAAAGGAGG + Intergenic
1194865059 X:99054974-99054996 TAGGAGAAACATCAATAAGGAGG - Intergenic
1194866188 X:99070911-99070933 TAGTAGACGCATAATCAAGTAGG - Intergenic
1196907526 X:120452269-120452291 TAGCAGAAGGAAAATAAAGTTGG - Intronic
1197707650 X:129646226-129646248 TAGCAGCAGCATAGGTAAAGGGG + Exonic
1199080715 X:143573953-143573975 TAGCAAAATCATCATTCAGGTGG - Intergenic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic
1201553552 Y:15244426-15244448 TTTCAGAAGTATAATTAAGAAGG - Intergenic
1202189002 Y:22221581-22221603 TACCAAAAGCATAAATAAGAAGG + Intergenic