ID: 1102941301

View in Genome Browser
Species Human (GRCh38)
Location 12:116944708-116944730
Sequence CAAAATGCTAATAGTTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 547}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102941299_1102941301 -2 Left 1102941299 12:116944687-116944709 CCCTAAATTAGTGTTGGAAAACA 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 547
1102941295_1102941301 24 Left 1102941295 12:116944661-116944683 CCTGTGATTAAGTAAACCTTTTG 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 547
1102941296_1102941301 8 Left 1102941296 12:116944677-116944699 CCTTTTGTTCCCCTAAATTAGTG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 547
1102941300_1102941301 -3 Left 1102941300 12:116944688-116944710 CCTAAATTAGTGTTGGAAAACAA 0: 1
1: 1
2: 2
3: 56
4: 497
Right 1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 547
1102941298_1102941301 -1 Left 1102941298 12:116944686-116944708 CCCCTAAATTAGTGTTGGAAAAC 0: 1
1: 0
2: 1
3: 14
4: 1053
Right 1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102941301 Original CRISPR CAAAATGCTAATAGTTAAAA TGG Intronic
905057018 1:35104414-35104436 CAAAATGCTATTAGTACATATGG - Exonic
905130369 1:35750950-35750972 AATAATGCTAATATTAAAAATGG - Intronic
906398586 1:45488411-45488433 CAAAAGGATAGTAGTGAAAATGG - Intronic
908871832 1:68621657-68621679 CAAATTGCTAAGAGAAAAAAAGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909132978 1:71763011-71763033 AAAAATGCTAAAAATAAAAAGGG + Intronic
909159522 1:72128870-72128892 CAAAATGTTAATAGCCTAAATGG + Intronic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909772022 1:79435644-79435666 CAAAATGGAAAAAGTAAAAAAGG - Intergenic
910514298 1:88041017-88041039 TAAAATGCCAATAGAAAAAATGG + Intergenic
911787280 1:101966832-101966854 CAAACTGCTAACAATAAAAAAGG - Intronic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912171337 1:107103403-107103425 CAAAAGGCACATAGTGAAAAGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912389727 1:109294516-109294538 CAAAATGCTTATAATTTAATAGG + Intronic
912428626 1:109616357-109616379 CAAAATGATAATGGTTATAAAGG - Exonic
912678953 1:111716095-111716117 CAAAATCCAAATTCTTAAAAAGG - Exonic
913306535 1:117433498-117433520 CTAAATGTAAATAGTGAAAATGG - Intronic
913614658 1:120546308-120546330 CAAAATTTTAATATTTCAAAAGG + Intergenic
914409682 1:147414189-147414211 CAAAAACCTAATTCTTAAAATGG + Intergenic
914575613 1:148964593-148964615 CAAAATTTTAATATTTCAAAAGG - Intronic
916369592 1:164075476-164075498 AAATATGCTAAAAGTTAACATGG - Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917190196 1:172408722-172408744 CAAAATAATAATAGTAAAACTGG - Exonic
917973720 1:180225296-180225318 CAAAATGCAAATAATGAAAGGGG + Intergenic
918009522 1:180573396-180573418 CACAGTGCTAATAGTACAAATGG + Intergenic
918150480 1:181794304-181794326 CAAAATGCCAGAATTTAAAACGG + Intronic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
919132910 1:193473528-193473550 CACAAAGCATATAGTTAAAAAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920869900 1:209785300-209785322 CAAATCGCTGGTAGTTAAAAAGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921526775 1:216227968-216227990 CAAAAGGGTCATAATTAAAAAGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922074374 1:222228207-222228229 CAAATGGCTAATATATAAAAAGG + Intergenic
922922449 1:229317782-229317804 CAAAATCATAACAGATAAAATGG - Intergenic
924647995 1:245897272-245897294 CAAAATGCCAGAAGCTAAAATGG + Intronic
1063268515 10:4480784-4480806 CATAATGCTAAAAATAAAAATGG - Intergenic
1065663491 10:28032412-28032434 CAAAAACCTTATAGATAAAATGG - Intergenic
1068727078 10:60315565-60315587 TAAAATACTAACAATTAAAATGG + Intronic
1071913313 10:90260763-90260785 CAATTTGCTAATATATAAAATGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073733734 10:106321691-106321713 TAAAATGCAAATAGAAAAAATGG + Intergenic
1074409030 10:113208586-113208608 AAAACTTCTTATAGTTAAAACGG - Intergenic
1075149095 10:119910586-119910608 CAAAATGTAAACAGTTTAAAAGG + Intronic
1075335726 10:121607709-121607731 CTAAATGCTAATACTCAGAAAGG + Intergenic
1077700916 11:4441713-4441735 CCAAATGCTATTGGGTAAAATGG + Intergenic
1077742738 11:4865132-4865154 TAAAATGAGAATAGTCAAAATGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078371220 11:10747483-10747505 AAATATGCTAATTATTAAAAAGG - Intergenic
1078589717 11:12629002-12629024 GACAATGCTAATAGTTACTATGG - Intergenic
1078592228 11:12652759-12652781 AAAAAAGCTAAAATTTAAAAAGG + Intergenic
1079437237 11:20469487-20469509 AAAAATGAAAATAGTTAAGATGG + Intronic
1079457232 11:20646924-20646946 CAAAATCCTTACGGTTAAAATGG - Exonic
1080410837 11:32023466-32023488 CACAATGCAAAGAGTTGAAAGGG - Intronic
1080560819 11:33460761-33460783 CAAAACGCAAATACTTAAGAGGG - Intergenic
1080624129 11:34013230-34013252 CAAGATAAAAATAGTTAAAATGG + Intergenic
1080839704 11:35972437-35972459 CAAATTGGTAATAGATATAATGG + Intronic
1081014247 11:37856349-37856371 CAAAAATCTGATTGTTAAAAAGG - Intergenic
1081412295 11:42774055-42774077 CAAAATCCTCATTTTTAAAATGG + Intergenic
1081690951 11:45078137-45078159 AAAAATCCTAAGAGTTGAAAGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082781542 11:57291971-57291993 CAAAATGCTAGTAGTTGATCTGG + Intergenic
1083600200 11:63942624-63942646 GAAAATGCTCCTAATTAAAATGG - Intronic
1083790746 11:64983989-64984011 AAAAATGCTTATATTTAATAGGG - Intergenic
1084074894 11:66765929-66765951 CTAAATAATAATAGTAAAAAAGG - Intronic
1085137645 11:74107653-74107675 CAAGATGCTAAATGATAAAAAGG + Intronic
1085519471 11:77129660-77129682 CATAATGCATATAGTCAAAATGG + Intronic
1085588866 11:77738146-77738168 AGAAAAGCGAATAGTTAAAAAGG + Intronic
1085774694 11:79355072-79355094 TGAAATTCTAAAAGTTAAAAAGG - Intronic
1086004349 11:82019317-82019339 CAAGATGGTGATAGTTAAAGAGG + Intergenic
1086547677 11:88016972-88016994 CAAAATGATAAATGTTAATAGGG + Intergenic
1086809145 11:91283515-91283537 TAAAATGATAATAGTACAAATGG - Intergenic
1087315473 11:96597520-96597542 TAACATGCAAATAGTTAAGAAGG - Intergenic
1087383155 11:97434458-97434480 CAGACTGCTAATAAGTAAAAAGG + Intergenic
1087517856 11:99187749-99187771 CACTATGCTAATATTTAAATTGG + Intronic
1087729086 11:101758208-101758230 CAAAATGTTAATAATTCATATGG + Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089081866 11:115782890-115782912 CAAAAAGCAAATAATTGAAATGG - Intergenic
1091079284 11:132651406-132651428 CAAAATACAAACAGTTAACAAGG - Intronic
1091094453 11:132806958-132806980 AAAAATGCAAATATTTAAAATGG + Intronic
1091523127 12:1268195-1268217 TAAATTGCTAAAAGTAAAAAAGG - Intronic
1093667718 12:21834319-21834341 CCAAATGTTAATACTTAATAGGG - Intronic
1093740018 12:22674965-22674987 CAAAATGCTTATAATTTAGAAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095319215 12:40805584-40805606 TAAAATGCTAACAGATATAAAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095441116 12:42239069-42239091 CAAACTCCTTATATTTAAAAAGG - Intronic
1095491938 12:42744033-42744055 CATAATGCAACAAGTTAAAATGG - Intergenic
1095608878 12:44103588-44103610 CAAAAGGCTAAACATTAAAAAGG - Intronic
1095721862 12:45409566-45409588 CAATATGCTAAATGTTAATATGG - Intronic
1095772707 12:45979314-45979336 AAAAATCCTAAGAGTTAAAGGGG + Intronic
1097105689 12:56622650-56622672 GAAAATCCTATTAGTTCAAAGGG - Intronic
1097503119 12:60431651-60431673 CAAAATGCTAGGATTTAAGAAGG + Intergenic
1099122189 12:78704791-78704813 CAAAAAGTTAATTTTTAAAAGGG + Intergenic
1099138055 12:78933574-78933596 CAAAATACTAATTTTTTAAATGG - Intronic
1099393855 12:82114619-82114641 CAAAATTCTAATTTTTTAAATGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099510167 12:83525128-83525150 CAAAATGCAAATAGAGAAATTGG + Intergenic
1099603007 12:84765268-84765290 CAAAATGGTAACTATTAAAAAGG - Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099816880 12:87660759-87660781 CAAAATCTTAATTGATAAAATGG - Intergenic
1099972556 12:89515124-89515146 CATAATGCTCAGAGTTGAAATGG - Intronic
1100024257 12:90108586-90108608 AATAATGCTGATAGTTTAAATGG + Intergenic
1100217182 12:92463821-92463843 CAAAATGCCAAGAGTTACCAAGG - Intergenic
1101067342 12:101036016-101036038 AAAAATGTTAAAAGTTAAAATGG + Intronic
1101394725 12:104336204-104336226 CAAAATACATATGGTTAAAATGG - Intronic
1102321288 12:111937043-111937065 CAAAGTGCTAATATTAGAAATGG - Intronic
1102583336 12:113906211-113906233 CCAAATGCTCATTGGTAAAATGG + Intronic
1102918152 12:116770960-116770982 CAAAATGTTACTAATAAAAATGG - Intronic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1104222675 12:126800501-126800523 AAAAATAATAATAATTAAAAAGG - Intergenic
1105283085 13:18980972-18980994 GAAAATGCTAAGAGTAATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105671551 13:22623173-22623195 TAACATGCTAATAGTTCTAATGG - Intergenic
1105672561 13:22636022-22636044 CAAACTGCTACGAGCTAAAAAGG - Intergenic
1105758085 13:23488032-23488054 AAAAAGGCTAATTTTTAAAAAGG + Intergenic
1105961523 13:25345623-25345645 TAAAATTCAAATAGTCAAAATGG - Intronic
1106533960 13:30622163-30622185 CTATATGCTAATAGCTAACAAGG - Intronic
1106672940 13:31926998-31927020 CAAAATGCAAACAGGTTAAAAGG + Intergenic
1107173000 13:37365482-37365504 AAAAATCCTACTATTTAAAAAGG - Intergenic
1107564382 13:41587021-41587043 CAAAATGGAAACAGTTGAAATGG + Intronic
1109056069 13:57550874-57550896 CAATATGCTAATGTTTGAAAAGG + Intergenic
1109087455 13:57993273-57993295 CAAAATGCTAAAACATAAAATGG - Intergenic
1109225622 13:59691086-59691108 CAAAATGCTGGGAGGTAAAAGGG + Intronic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109429832 13:62217198-62217220 CAATTTGCTAATATTTTAAAAGG + Intergenic
1109719836 13:66261166-66261188 CAAAATGAAAATAGTTGAATTGG - Intergenic
1110344038 13:74425311-74425333 CATAATCCTAATACCTAAAATGG + Intergenic
1110441805 13:75534659-75534681 CAAAAAGCTAGTAGTAAAAAAGG + Intronic
1110784041 13:79502302-79502324 CATCATGCTAATTTTTAAAAAGG + Intronic
1110971802 13:81772377-81772399 CAAAAGTACAATAGTTAAAATGG - Intergenic
1111953304 13:94728477-94728499 CAAAATGCTATTTCTTAAACTGG + Intergenic
1112427337 13:99315052-99315074 GGAAATGCTAAAGGTTAAAAGGG - Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112914470 13:104529854-104529876 CAAAATGCTATTTCTTAACATGG + Intergenic
1113344381 13:109460483-109460505 CAAAGTGATAGTAATTAAAATGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114882851 14:26808112-26808134 CAAAATACTAATAGCTCAGATGG + Intergenic
1115413833 14:33107725-33107747 CAAAATGATAGAAGTTTAAAAGG + Intronic
1116278295 14:42866524-42866546 CAAAATTCTCATAGATACAATGG + Intergenic
1116478717 14:45371678-45371700 AAAAGTGCTAAAACTTAAAAAGG - Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116939062 14:50772127-50772149 CAAAAGGCTCCTGGTTAAAAGGG + Intronic
1117047871 14:51830896-51830918 CAAAAGCTAAATAGTTAAAATGG + Intronic
1117274997 14:54184370-54184392 TAAGTTGCTAATATTTAAAAAGG + Intergenic
1117702289 14:58426158-58426180 CAAAAAAATAATAATTAAAAGGG + Intronic
1118505435 14:66405713-66405735 CAGGATGCTAATAGTTTAATGGG + Intergenic
1118561809 14:67093284-67093306 CAAAATGCTAATAGTGGCCAGGG - Intronic
1118844177 14:69534207-69534229 AGAAATATTAATAGTTAAAATGG - Intergenic
1120268694 14:82282880-82282902 CTAAATGTTAACATTTAAAATGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120903315 14:89594885-89594907 CAAAATGCCAAGAGTAGAAAAGG - Intronic
1121064452 14:90949091-90949113 CACAAAGCTAATTATTAAAAAGG + Intronic
1121846571 14:97177419-97177441 CAAATTGCCAACATTTAAAAAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123217884 14:106829459-106829481 AAATATGCTATTAGTAAAAATGG - Intergenic
1124682574 15:31747731-31747753 CAAAATCCTATTAATTACAAAGG + Intronic
1124811892 15:32948196-32948218 TAAAATGTTAATAGATTAAAGGG - Intronic
1124941033 15:34218158-34218180 CGAAATGCAAACAGTCAAAATGG + Intergenic
1125133788 15:36316192-36316214 TCAAATGATAATAGTTAAATGGG - Intergenic
1126304312 15:47237720-47237742 TAAAACGGTCATAGTTAAAAGGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126842550 15:52731349-52731371 CAAAATTCAAATAGTACAAAAGG + Intergenic
1126962556 15:54013920-54013942 CCAAATTCTAATAGATAAAATGG + Exonic
1127143486 15:56000777-56000799 AAAATTGCTAATAATTGAAATGG - Intergenic
1127209903 15:56762964-56762986 GAAAATGATAATAGCCAAAAAGG - Intronic
1127355137 15:58191074-58191096 CAAAATGCTTATACTTCAAATGG + Intronic
1128673008 15:69588333-69588355 CAAAATGCAAAGAGAAAAAAAGG - Intergenic
1129122121 15:73405163-73405185 CAAAATGCTAAGATTTGACAAGG - Intergenic
1129527716 15:76231889-76231911 CAAAAGGATATTTGTTAAAATGG + Intronic
1130003779 15:80073178-80073200 TAATATGCTCATAATTAAAAAGG + Intronic
1130006645 15:80105587-80105609 CAAAATTCTATGAGTTAGAAAGG + Intronic
1130171570 15:81520154-81520176 AAAAAGGCTAATAACTAAAATGG + Intergenic
1130831441 15:87605143-87605165 CAAAAAGCTAGGAGTTGAAAGGG - Intergenic
1131368319 15:91858408-91858430 CAAAATGTTAATAATTATTAAGG + Intronic
1131755796 15:95559729-95559751 CAAAATAGTAACAGATAAAATGG - Intergenic
1132410734 15:101576746-101576768 CAGAATGCTAAAAATTAAATGGG + Intergenic
1132874912 16:2132746-2132768 CAAAATGCTTGCAGATAAAAGGG + Intronic
1134312332 16:13086603-13086625 CAAAATGGTACTAGTGAAAATGG + Intronic
1134390455 16:13815297-13815319 GAAACTGCTTATAGTCAAAACGG - Intergenic
1134520079 16:14914636-14914658 CAAAATGCTTGCAGATAAAAGGG - Intronic
1134553854 16:15151596-15151618 CAAAATGCTTGCAGATAAAAGGG + Intergenic
1134707752 16:16313290-16313312 CAAAATGCTTGCAGATAAAAGGG - Intergenic
1134959791 16:18398835-18398857 CAAAATGCTTGCAGATAAAAGGG + Intergenic
1135333173 16:21578304-21578326 TAAAATGCTAATATTAGAAAAGG + Intergenic
1137870912 16:51949417-51949439 TAAACTGCTAATGGTTAATAGGG + Intergenic
1138002068 16:53291299-53291321 CAAACTGCTTAAAGCTAAAAAGG + Intronic
1138173001 16:54870480-54870502 GAAAATGATAATATTGAAAACGG + Intergenic
1138277776 16:55748726-55748748 CAAAATGAAAACAATTAAAATGG - Intergenic
1139081941 16:63532463-63532485 CAAAATGCTTATAGTACAAAGGG + Intergenic
1139789166 16:69418556-69418578 CAATTTGCTAATATTTTAAAAGG - Intergenic
1140146154 16:72311481-72311503 AATATTGCTGATAGTTAAAAGGG + Intergenic
1140639807 16:76958782-76958804 CAGGAAACTAATAGTTAAAATGG + Intergenic
1143693963 17:8596612-8596634 TAAAATGCTTATTCTTAAAAGGG + Intronic
1143943927 17:10572732-10572754 CAAAATTATAATAGATAAACGGG - Intergenic
1145229460 17:21162331-21162353 CAACTGGCAAATAGTTAAAATGG + Intronic
1148791554 17:50175996-50176018 CAAAATGCCAAGAGTCCAAAGGG - Intergenic
1149471342 17:56917614-56917636 CAAAATGATCATAGTTATTATGG - Intergenic
1149839414 17:59945930-59945952 CAAAGTGCTATAATTTAAAAGGG + Intronic
1150994489 17:70300284-70300306 CGAAGAGCTAATTGTTAAAAAGG - Intergenic
1153332749 18:3890549-3890571 CAAAATGAAAAAAGTTAAAAGGG - Intronic
1153512124 18:5867260-5867282 AAAAATGCAAATAATTAAAAAGG + Intergenic
1154340336 18:13497584-13497606 AAAAATGGTAATAATTAAAAAGG - Intronic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1155781330 18:29839817-29839839 CAAAATGAGAATATTTTAAAGGG - Intergenic
1155853538 18:30802587-30802609 GAAAATGTTAAAATTTAAAAAGG + Intergenic
1156136712 18:34048924-34048946 CAAAATGCTTTTAATTTAAAGGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156604887 18:38654777-38654799 TAGAATACTCATAGTTAAAAAGG - Intergenic
1156929473 18:42624479-42624501 CAATATGCTAATATTTAGGATGG + Intergenic
1156999063 18:43502629-43502651 CAGATTGAAAATAGTTAAAATGG + Intergenic
1157663435 18:49465811-49465833 CAAACTAATAATAGTTAACATGG + Intergenic
1158102930 18:53851094-53851116 CAAAAAGCAAGCAGTTAAAAGGG - Intergenic
1158162448 18:54500809-54500831 CAAAATCTAAATAGTAAAAAAGG - Intergenic
1158793875 18:60817784-60817806 CAAAATGCTAATATCTTCAAGGG + Intergenic
1159544944 18:69828312-69828334 TAAAATGGTAAATGTTAAAATGG - Intronic
1159562543 18:70010612-70010634 CAAAATGCTCACAGGTGAAAGGG + Intronic
1159828350 18:73242541-73242563 AAAAATGCTTATATTTCAAAGGG + Intronic
1159903580 18:74070263-74070285 CAAAATAATATTAGTTACAAAGG - Intergenic
1159941370 18:74411507-74411529 CAAAATGGTAAATTTTAAAAAGG - Intergenic
1160144716 18:76354154-76354176 CAAGAAGTTAATACTTAAAAGGG - Intergenic
1160255115 18:77241843-77241865 CAAAATGATAAAAATTAAATAGG - Intergenic
1161201059 19:3015070-3015092 AAAAAAGCTATTAGGTAAAAAGG + Intronic
1163474907 19:17520156-17520178 AAAAATGCAAATAGTTACAGTGG + Intronic
1165540122 19:36486132-36486154 CAAAGTCCTAAAAGATAAAAAGG + Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166610738 19:44192934-44192956 CAAGTTGCCTATAGTTAAAAGGG - Intergenic
1168301932 19:55409833-55409855 CAAAATGCTTATCGGCAAAATGG - Intergenic
1168570004 19:57458729-57458751 CAAAATAGTCATAGTAAAAATGG - Intronic
925551542 2:5081031-5081053 AAAAATCCTAATAATTAAAATGG - Intergenic
926526151 2:13983655-13983677 CAAAATGCTCATAGATTAAGGGG - Intergenic
927439219 2:23099040-23099062 AAAAATTCAAATAGTTTAAAAGG - Intergenic
927583297 2:24274781-24274803 GAAAAAGCTAATAGTTACTAGGG - Intronic
928295510 2:30079474-30079496 CAAAATCCTAAGTGTTAGAAAGG - Intergenic
928350086 2:30543346-30543368 CAATATGCTAATAGCTTTAAAGG + Intronic
928634246 2:33226985-33227007 TAAAAAGCCAATAGATAAAATGG - Intronic
928895521 2:36258264-36258286 GAAAATACCAATAATTAAAATGG - Intergenic
928902841 2:36339071-36339093 CAAAAGGCTAATATTTGTAAAGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
930405498 2:50950533-50950555 CAAAATGTTAATAGCAACAAAGG - Intronic
930701779 2:54465035-54465057 AAAAATTCTAATTTTTAAAAAGG + Intronic
930726527 2:54687063-54687085 CAAAATGCAAACATTTTAAAGGG + Intergenic
930775785 2:55168826-55168848 CAACATGGTAAGAGTTAAAATGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931370727 2:61660345-61660367 CAAAATAGTATTAGTTAGAAGGG - Intergenic
932184010 2:69676033-69676055 AATAATAATAATAGTTAAAATGG + Intronic
932383360 2:71306662-71306684 CAAAATGGTAATAGTGTACATGG + Intronic
933626485 2:84606372-84606394 CAAAAAGCTTATAATTGAAATGG + Intronic
933991400 2:87636629-87636651 CATAATGCATATATTTAAAAAGG - Intergenic
934975630 2:98800226-98800248 GAAAATGCTAAAATTTACAAAGG + Intronic
935694059 2:105755658-105755680 CAAAATACTAACATTTAAAAAGG - Intronic
936302442 2:111314193-111314215 CATAATGCAAATATTTAAAAAGG + Intergenic
936838648 2:116741105-116741127 TAAACTGGTGATAGTTAAAAAGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938261447 2:129898314-129898336 CCAAATGCTAATAGATCTAAAGG + Intergenic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
939289946 2:140181135-140181157 GAAAATGCTAAGAGTTAACTGGG - Intergenic
939358279 2:141133320-141133342 GAAAATGCTAATATATCAAATGG - Intronic
939458023 2:142463150-142463172 TAAAATGCTAATCTTTAAACAGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939549382 2:143595119-143595141 CAAAATGCAAAAAGCTAAATTGG + Intronic
939779280 2:146424368-146424390 CATAATGCTTTTATTTAAAAAGG + Intergenic
939793573 2:146612428-146612450 CAAAATACTAACAAATAAAATGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940587922 2:155678835-155678857 TAAACTGCTAATATTTAAATAGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941134132 2:161692216-161692238 AAAAATGCTAATTTATAAAAAGG - Intronic
942009990 2:171751818-171751840 CAAACTTCTAAAAGTTCAAATGG + Intergenic
942091889 2:172500198-172500220 CAGAATCCTGATATTTAAAATGG - Intronic
942761938 2:179409951-179409973 CAAAATACTTAGAGTTAAAAAGG + Intergenic
943579436 2:189667646-189667668 CAAAATGCTAAAAGCTTTAAGGG - Intronic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
944167268 2:196736168-196736190 CAAAAAGCTAGCACTTAAAATGG - Intronic
944270359 2:197777439-197777461 CAAACTTCTATTAGTTTAAAAGG - Intronic
944704300 2:202273463-202273485 TAAAATGATAAAACTTAAAATGG - Intronic
944752095 2:202720034-202720056 CAAATTACTATTAGTTACAAAGG - Intronic
945402274 2:209398514-209398536 GAAAATGCAAATAATTAACATGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945936768 2:215910338-215910360 TAATATGCTAATAGTTATGAGGG + Intergenic
946026892 2:216677246-216677268 CAAATGGGTAATATTTAAAACGG - Intronic
946829751 2:223716418-223716440 TAAACAGCTATTAGTTAAAAAGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948032045 2:234826743-234826765 AACAATGCAAATATTTAAAAAGG + Intergenic
948340108 2:237243154-237243176 CAAAATGCAACTGGTCAAAAAGG + Intergenic
1169384181 20:5133993-5134015 CAAAATGTTAAATGTTAAAAAGG + Intronic
1169605454 20:7313494-7313516 CAAAATGATTATGGCTAAAAGGG - Intergenic
1169872942 20:10266757-10266779 CAAAATGTAAAGAGTGAAAATGG + Intronic
1170452327 20:16496512-16496534 CAAATTGCAAACAATTAAAATGG + Intronic
1171187713 20:23135003-23135025 AAAAATACTAATAGATAAATTGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173546200 20:43900067-43900089 GAAAATGCTTAGATTTAAAATGG + Intergenic
1177318059 21:19486782-19486804 CTAAATACAAATAGGTAAAACGG - Intergenic
1177548862 21:22595303-22595325 CACAATATTAATAGTTAAAAAGG + Intergenic
1177616435 21:23527743-23527765 CAAAATTATAGTAGTCAAAACGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178078711 21:29038757-29038779 CAAAATGTAAATAATAAAAATGG - Intronic
1178253984 21:31033634-31033656 CAAAATGCTATTATGTAAATGGG + Intergenic
1178389448 21:32186151-32186173 CAAAGTGTTAGGAGTTAAAAAGG - Intergenic
1179300457 21:40104481-40104503 CCAAAAGCTAATTGATAAAAAGG + Intronic
1179365299 21:40753480-40753502 CAAAGTGTCAATAGATAAAATGG + Intronic
1181183727 22:21086348-21086370 CAAATTGCAAATAGGAAAAAAGG + Intergenic
1181726685 22:24816056-24816078 CCAAATAATAATAATTAAAAAGG - Intronic
1183761928 22:39828954-39828976 TAAAATGAGAATAGTTAAAGAGG + Intronic
1184050876 22:42003492-42003514 CAAACTGCTGATAAATAAAAGGG + Intronic
949734994 3:7161355-7161377 CAAATCGCTAGTAGTTAAAAAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951001727 3:17569968-17569990 CAAAATGAAAATATTTTAAAAGG + Intronic
951546871 3:23834978-23835000 CAAATTGATAATGTTTAAAATGG + Intronic
951649807 3:24938573-24938595 CAACATAAAAATAGTTAAAATGG + Intergenic
951881130 3:27482961-27482983 TATAATCCTAAAAGTTAAAAGGG + Intronic
951940560 3:28073951-28073973 CAAAATGCTAAGATTTGACAAGG + Intergenic
952451565 3:33439000-33439022 CAAATTCCTAACAGTTAAAAAGG + Intronic
953807881 3:46087044-46087066 CAAAATGACAATAGTTATCATGG + Intergenic
955301623 3:57785280-57785302 GAAAATCCTATTTGTTAAAATGG - Intronic
955643937 3:61116020-61116042 AAAAATGCTAGAAGATAAAAGGG + Intronic
956026111 3:64984881-64984903 CAAAATGATAATTTTTAAAAAGG + Intergenic
956612405 3:71137459-71137481 CAAAATATTAATAGTACAAATGG - Intronic
956681112 3:71782112-71782134 CAAAATGCAAATATTTGAAGGGG - Intronic
956737423 3:72248429-72248451 CAGAACCCTAATATTTAAAATGG + Intergenic
956838868 3:73118420-73118442 CAAAAAGATAATAGTAATAATGG - Intergenic
957318424 3:78597891-78597913 AAAAAGGTTAATAGTTACAATGG + Exonic
957475756 3:80721745-80721767 CAAAATCCTAAGAGTTACCAGGG - Intergenic
957526206 3:81381121-81381143 CAAAATACTCATTTTTAAAAAGG + Intergenic
957724709 3:84048905-84048927 CATATTGCCAAAAGTTAAAATGG + Intergenic
957827883 3:85473170-85473192 CAAAATTCTACCATTTAAAATGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959272348 3:104228885-104228907 TAAATTGTTAATAGGTAAAAAGG - Intergenic
959554214 3:107698277-107698299 TAAAATGGTAAAAGTTTAAAAGG - Intronic
959633973 3:108540973-108540995 CAAAAAGCTAAAACTTAACAAGG + Intergenic
959936053 3:112030202-112030224 CAAAATGTTAAAAGATAGAAAGG + Intergenic
960252886 3:115476071-115476093 CAAAATGCTTATGGTTGCAAAGG + Intergenic
960274298 3:115709716-115709738 TAAAATGCTAATATGAAAAAAGG + Intronic
961021738 3:123513357-123513379 CAAAATACTAATTAATAAAAAGG + Intronic
961855114 3:129862396-129862418 CAAAATGTTAATAGGAGAAATGG + Intronic
961976180 3:131027197-131027219 CAAAATGTAAATGTTTAAAAAGG + Intronic
962052869 3:131836221-131836243 CAAAATGTAAATACATAAAAGGG + Intronic
962240106 3:133744961-133744983 CACAATGCTAAAGGTGAAAAGGG + Intergenic
962508878 3:136078257-136078279 CAAAAAGCTAAAAGTTAAATTGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963149369 3:142028943-142028965 AAAAATGCTTAAAGTAAAAAGGG + Intronic
963362088 3:144287372-144287394 GAAAATGTTATTAGTTACAATGG - Intergenic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963495629 3:146056914-146056936 CAAAAATGTAATAGATAAAATGG + Intergenic
963628204 3:147700471-147700493 CAAACTGATAATATTTATAAGGG - Intergenic
963731028 3:148972720-148972742 CAAATTTCTAAAAGTTGAAATGG - Intergenic
964151954 3:153536594-153536616 CAAATTGCTAACAGTTAATATGG - Intergenic
964215903 3:154281941-154281963 TGAAATGCTGTTAGTTAAAAGGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964747826 3:160028284-160028306 CAAAATGATGACAGTTAGAAGGG - Intronic
965101354 3:164302974-164302996 CAAAATGCAAATACATACAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965411674 3:168339243-168339265 CAAAATGTCAATAGATAAATAGG + Intergenic
965583128 3:170290690-170290712 CAAAATACAAAGAGTAAAAAAGG - Intronic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
965853359 3:173058024-173058046 CAAAATTCTATTATTAAAAAGGG + Intronic
966717216 3:183025260-183025282 CTGAATGCAAATGGTTAAAATGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967371449 3:188750960-188750982 GAAAATACTAAAACTTAAAAAGG - Intronic
967408724 3:189146022-189146044 AAAATTGGTAGTAGTTAAAAAGG + Intronic
967563108 3:190940313-190940335 CAAAATGCTAAAACTTATGAAGG - Intergenic
968317042 3:197733913-197733935 CACTATGCTAATAGTAACAACGG - Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970611784 4:17731774-17731796 CAGAAAGTTAAAAGTTAAAAAGG + Intronic
970633465 4:17980604-17980626 AAAATGGCTAAGAGTTAAAAAGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972154453 4:36141919-36141941 CAAAGGGCTAATAGATCAAAAGG + Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973813438 4:54595644-54595666 CATAAAGTTTATAGTTAAAATGG + Intergenic
974692888 4:65322907-65322929 CAAAATGGGAATGGTTACAACGG + Exonic
974706632 4:65526159-65526181 GACAATTCTAATAGTAAAAAGGG + Intronic
975086649 4:70349308-70349330 CAACATTCTAACAGTTTAAAGGG - Intergenic
975147472 4:70985137-70985159 GAAAATGCTAATATATAAAATGG - Intronic
975408896 4:74024695-74024717 CAAAATGATAACAATAAAAAGGG - Intergenic
977363110 4:96031845-96031867 TAAAATGCTAATGAATAAAAAGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977495295 4:97768248-97768270 CACAATGCAAAGACTTAAAATGG + Intronic
978069040 4:104443201-104443223 CAAACTGCTAGTAGTTTAATTGG + Intergenic
978805571 4:112796499-112796521 AAAAAATTTAATAGTTAAAAAGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979628673 4:122875965-122875987 AAAAATGTAAATAGTTAACAGGG + Intronic
979974348 4:127178060-127178082 CAAAATCAAAATATTTAAAAAGG - Intergenic
980029302 4:127808066-127808088 TAAAATGCTTCTAGTTCAAATGG - Exonic
980341939 4:131561613-131561635 AAAATTACTAATAGGTAAAAAGG + Intergenic
980569322 4:134592266-134592288 CAAACTGCTAAAAATAAAAATGG - Intergenic
980573935 4:134661344-134661366 TAGAATGTTAATGGTTAAAAAGG + Intergenic
980753717 4:137128045-137128067 AAATATGCTAACATTTAAAATGG + Intergenic
980846096 4:138326918-138326940 TAAAATGATAAAAGGTAAAAAGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981462224 4:145026835-145026857 CAGAATGTTAATTTTTAAAATGG + Intronic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981698987 4:147587320-147587342 ACAAATGCTATTATTTAAAAAGG - Intergenic
982757874 4:159245680-159245702 CAATAAGGTAAAAGTTAAAATGG - Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984100181 4:175475033-175475055 CAAAATGCAAAAAATAAAAATGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984273144 4:177573067-177573089 CAAAATACAAATATTTAAATTGG + Intergenic
984385585 4:179053072-179053094 CAAACTGCGAAGAATTAAAATGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
986122683 5:4856750-4856772 CATAATGCTATCAATTAAAATGG + Intergenic
986528569 5:8708738-8708760 CATAATTCTAAAAGTTAAGAGGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986683549 5:10255318-10255340 CAAAATGTTAATAAGTAAACTGG + Intronic
987501596 5:18717648-18717670 CAAAATTCTAAAAACTAAAAAGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987758717 5:22131074-22131096 CAAAATTATAATGGATAAAATGG - Intronic
987974506 5:24995610-24995632 CATCAACCTAATAGTTAAAATGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988147140 5:27324307-27324329 TAAAATGTTTTTAGTTAAAATGG - Intergenic
988277049 5:29094610-29094632 AAAAATCCTTATAGTTAAAGTGG + Intergenic
988294906 5:29344206-29344228 CAAAATTCTAAAAGATAAGAAGG + Intergenic
988418868 5:30980806-30980828 AGAAATGAAAATAGTTAAAAGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988719057 5:33858348-33858370 CAAAATGCTTACAGTAGAAAAGG + Intronic
989662875 5:43818117-43818139 AAATATTCTAATAGTGAAAATGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989841289 5:46074694-46074716 CAAAAAGCTTATGGTGAAAAAGG + Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990822412 5:59857617-59857639 CAAAATGTTACTAGTTCTAAAGG - Intronic
991133450 5:63153669-63153691 CAACATTATAATTGTTAAAATGG + Intergenic
991172960 5:63649770-63649792 TTAAATGCTAATAGTTAACATGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991893418 5:71364513-71364535 CAAAATTATAATGGATAAAATGG - Intergenic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992567788 5:78017558-78017580 CAAGATGCTAATTCTTTAAATGG - Intronic
992717218 5:79522691-79522713 CAAAATGCTACTCTTTACAAAGG + Intergenic
992728889 5:79638189-79638211 CAAAATGCCAATAGTACAGAGGG - Intronic
992822288 5:80509437-80509459 CAAAGTGCTGATACTTAAAGAGG - Intronic
993169035 5:84392924-84392946 CATAATGCTAATATTAAAATTGG + Intergenic
993427728 5:87789155-87789177 GAAAACAATAATAGTTAAAAGGG + Intergenic
993514703 5:88816385-88816407 CAAATTGCTAAGGGATAAAATGG + Intronic
993617461 5:90131353-90131375 GAGAATGCAAATAGTTATAATGG + Intergenic
993828008 5:92717031-92717053 TAAAATACTAATAGCTAAAAAGG + Intergenic
993965320 5:94353117-94353139 CAAAAAGATAAAAGTTCAAAAGG + Intronic
994079357 5:95689420-95689442 CAAAATACTTATTTTTAAAAAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994800996 5:104375453-104375475 CAAAATGGAAATAGTGAAAGAGG + Intergenic
995142821 5:108751902-108751924 CAAGATTCAAATACTTAAAAAGG - Intronic
995194907 5:109355849-109355871 CAAAATGATAAAGGTTTAAAGGG - Intronic
995681583 5:114726549-114726571 CAAAATTTTAATAGTTAAAGAGG - Intergenic
996292814 5:121873940-121873962 AAAAATGCTAATATTTGAAATGG - Intergenic
997912263 5:137887828-137887850 TAAAATTCAAATATTTAAAACGG + Exonic
1000484501 5:161823771-161823793 CAATATACTAATAATTCAAATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000775151 5:165410434-165410456 CAAATTGAGACTAGTTAAAATGG - Intergenic
1002017469 5:176336334-176336356 CAAAAAGCTGATAGTTGAACAGG - Intronic
1003595499 6:7470762-7470784 GAGAATGCTAGCAGTTAAAAAGG - Intergenic
1004093703 6:12531612-12531634 CAAAATGTTAATAATAGAAAAGG + Intergenic
1004704001 6:18106257-18106279 CAAAGTGCTCAAAGATAAAATGG + Intergenic
1005200165 6:23335695-23335717 CAAAGTGCAAATATTTAATAAGG - Intergenic
1005375767 6:25180990-25181012 TAATATGTTAATAGTTAATATGG - Intergenic
1005934594 6:30510780-30510802 AATAATTCCAATAGTTAAAATGG + Intergenic
1007265133 6:40589995-40590017 CAAAATGCCCATTATTAAAATGG - Intergenic
1007498012 6:42274833-42274855 CAAAATTCAAAAGGTTAAAATGG + Intronic
1007971326 6:46054965-46054987 CCAAATGGTAATAGCAAAAAAGG - Intronic
1008206178 6:48660620-48660642 CAAAATGTCAATAGTGCAAATGG + Intergenic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1008469572 6:51868553-51868575 CAAAATGCCAATAGTGCCAAGGG + Intronic
1009318593 6:62256266-62256288 AAAAATGCTAACAGTTTACAAGG - Intronic
1010015595 6:71102381-71102403 AAAAATGCAAATAATTAAAGCGG - Intergenic
1010462322 6:76127603-76127625 AAAAATGTTCATAGCTAAAAAGG - Intergenic
1010613266 6:77982561-77982583 AAAAGTGCTAATTTTTAAAAAGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010956685 6:82098318-82098340 TAAAATGTTAAGAGTAAAAAAGG - Intergenic
1011116839 6:83902951-83902973 CAAAATAGTATTTGTTAAAAGGG + Intronic
1011783834 6:90821465-90821487 GAAAGTGCTAGTAGTTAAATAGG + Intergenic
1011830991 6:91371223-91371245 CAAAATGGTAATTATTATAATGG + Intergenic
1011874113 6:91935339-91935361 AAAAGTGCTAATAATTAAACGGG + Intergenic
1012015614 6:93846119-93846141 CAAAACTCAAATAGTTAAGAAGG + Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013008667 6:106099606-106099628 CAACATGTTATTAGTTCAAAGGG - Intronic
1013382099 6:109584293-109584315 CAAATAGCTAATATTTGAAAGGG + Intronic
1013587516 6:111592696-111592718 CAAAATTATAAAAGTTTAAAAGG - Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015743710 6:136486852-136486874 CAAAATGGCAAATGTTAAAATGG + Intronic
1015922729 6:138281708-138281730 GAAATTTCTAATAGTTAAATAGG - Intronic
1016208379 6:141498371-141498393 CTAAATGTTAATGGTTAAGAAGG + Intergenic
1016482900 6:144501657-144501679 GAAAATGGTAATAATTTAAATGG - Intronic
1017363981 6:153610940-153610962 TAAAGTGCTAATTGTTCAAAAGG - Intergenic
1017410234 6:154160374-154160396 TAAAATGCTAATACCTACAATGG - Intronic
1017773097 6:157658334-157658356 CAAAAGGCTCACAGCTAAAAGGG - Intronic
1017929578 6:158940020-158940042 CCAAATGCTAATGGTGACAAAGG + Intergenic
1018019312 6:159744222-159744244 CAAAGTTCTAACAATTAAAAAGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020854991 7:13408438-13408460 TAAAATGTTAAAAGTAAAAATGG - Intergenic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020942017 7:14552086-14552108 AAATATGCTAACAGTTTAAAAGG + Intronic
1020997921 7:15287870-15287892 CAAAATGCCAGTAATTGAAAAGG - Intronic
1021007230 7:15413525-15413547 CAAACTGCTAATATTTTAAAAGG + Intronic
1021955644 7:25821805-25821827 GAAAATGTTAATAATTAGAAAGG + Intergenic
1022252256 7:28620079-28620101 CAAAATAATAATTTTTAAAACGG + Intronic
1022305114 7:29139810-29139832 CAACATGCCAATAGTTAGAAGGG + Intronic
1023493279 7:40767408-40767430 CAAAATGCTATTGGTCCAAAGGG + Intronic
1024677776 7:51652889-51652911 CAATATCCTCATATTTAAAATGG + Intergenic
1024845766 7:53640207-53640229 AAAATTGCTAATAGGTAGAATGG - Intergenic
1026796620 7:73369872-73369894 GAAAATGCTAACAGTGAGAAGGG - Intergenic
1027979272 7:85196830-85196852 CAAAATGCCAATAGTTACTGAGG + Intergenic
1028166269 7:87541324-87541346 CAAAATGAATATAGTGAAAATGG + Intronic
1028809931 7:95074367-95074389 CAAAATCCTAATAATAAAGACGG - Intronic
1030343522 7:108407825-108407847 CAAACTGCACATACTTAAAATGG - Intronic
1030579228 7:111332241-111332263 CAAAAATCGAATAGTAAAAAAGG + Intronic
1030589885 7:111467612-111467634 AACAATGATCATAGTTAAAAGGG - Intronic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031690760 7:124784725-124784747 CATAATGCTTTTAGTAAAAAAGG + Intronic
1032874991 7:136028792-136028814 CAAAATTCAAATAAATAAAATGG - Intergenic
1033015834 7:137670663-137670685 CAATATCCTAATGGTGAAAAAGG + Intronic
1035064137 7:156093187-156093209 AAAAATTCTAATAGGGAAAAAGG - Intergenic
1036002274 8:4620370-4620392 CAAATTCCTTATATTTAAAATGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037283106 8:17265736-17265758 GAAAATGATCATAGTTAGAAAGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1038911229 8:31967143-31967165 GAAAAGCCAAATAGTTAAAAAGG + Intronic
1039227171 8:35401105-35401127 TAAAATACTCATAATTAAAAAGG + Intronic
1039332082 8:36548827-36548849 GAATATGCTAATAATTACAACGG - Intergenic
1039551121 8:38443702-38443724 AAAAATAAAAATAGTTAAAATGG + Intronic
1040866230 8:52051341-52051363 CAAAATGGGAATAATTAAACTGG - Intergenic
1041871769 8:62642802-62642824 AAAAATGGTAATATATAAAAAGG - Intronic
1042738440 8:72015655-72015677 CTAAGTGCTAAGACTTAAAATGG + Intronic
1043315147 8:78911286-78911308 CAAAATGTTAATAGTGAACATGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044445252 8:92267627-92267649 CAAAATGTTAATAGAAAATAAGG - Intergenic
1044670483 8:94675460-94675482 CAAAATGCTAAAAGATAAAAAGG - Intronic
1045412767 8:101935479-101935501 CAGAAAGCAAATGGTTAAAATGG + Intronic
1045845759 8:106634051-106634073 CAAAATGGTACTATGTAAAATGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045976901 8:108139631-108139653 CAGAATGATAGTAATTAAAATGG + Intergenic
1046516058 8:115262342-115262364 CAAAAATCAAATATTTAAAATGG + Intergenic
1047040675 8:120991168-120991190 AATAATGCTATTTGTTAAAAAGG - Intergenic
1047950588 8:129931113-129931135 TAAGATGCTAATAAATAAAATGG + Intronic
1048143163 8:131815216-131815238 CAAATTGCAAAAAGTTAAAAAGG - Intergenic
1050195853 9:3083649-3083671 AAAGATACTAATAGTTAAAGAGG - Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051753835 9:20373606-20373628 CAAAATAAAAATAGTGAAAAGGG + Intronic
1052305917 9:27009749-27009771 CATAATGCTAACAGGTAAAAAGG - Intronic
1052809656 9:33045930-33045952 ATAAATGCTAACATTTAAAAGGG + Exonic
1053444708 9:38143066-38143088 CAAAATGCAAACAGTTCAGAAGG + Intergenic
1055777952 9:79786613-79786635 CAGAAGGCCAATAGTTGAAAAGG + Intergenic
1056057470 9:82841881-82841903 CAAAATACTTTTAATTAAAACGG + Intergenic
1057239748 9:93398558-93398580 GAAAATGTTAACAGTGAAAAGGG + Intergenic
1057328095 9:94084851-94084873 TAAACTGCCAATATTTAAAAAGG - Intronic
1058248676 9:102663823-102663845 CAAATGGCAAACAGTTAAAATGG - Intergenic
1058577367 9:106418209-106418231 AAACATGTTAATAGTGAAAACGG + Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059783032 9:117549933-117549955 CAACTTTCTAATAGTTAAATTGG - Intergenic
1060313233 9:122483862-122483884 AAAAATGTTATTAGTTGAAAAGG + Intergenic
1060803562 9:126560357-126560379 CAAGATGCTAATTAATAAAAGGG + Intergenic
1061379016 9:130243244-130243266 CACTTTGCTAATCGTTAAAATGG - Intergenic
1203650374 Un_KI270751v1:113683-113705 TAAAATGGTAAGAATTAAAAAGG + Intergenic
1186595277 X:10974588-10974610 TAAAATTCTAATACTAAAAATGG + Intergenic
1187805219 X:23112217-23112239 CAATATGTTAACATTTAAAAGGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188737002 X:33729093-33729115 CAATATTCTCATAGTCAAAAAGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189571078 X:42297891-42297913 CAAAATAATAATTTTTAAAATGG + Intergenic
1189974703 X:46449158-46449180 CAAAATGCAAATTGTGAGAAAGG + Intronic
1190003937 X:46716655-46716677 CAATTTGCTAATGGTTACAATGG - Intronic
1190619668 X:52272932-52272954 CAAAATGTCTATAGTTAAATTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191267778 X:58418666-58418688 CAAAATGCCTAGAGTGAAAAAGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192931940 X:75815387-75815409 CAAACTGCTCAAAGCTAAAAGGG + Intergenic
1193214690 X:78849878-78849900 CATAATGCCAATATTTTAAAGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193339367 X:80329293-80329315 CAAAATGGGAAAAATTAAAAAGG - Intergenic
1193929629 X:87536132-87536154 CAAAATAGTAACAGTTTAAATGG - Intronic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194098220 X:89670248-89670270 AAAAATGGAAATAATTAAAAAGG - Intergenic
1194292682 X:92094073-92094095 CAAAATATAAATAGGTAAAAAGG - Intronic
1194690870 X:96982671-96982693 CAAAATGCCAATAATTAATAGGG - Intronic
1195636049 X:107117426-107117448 TGAAATGGTAATAGTGAAAATGG + Intronic
1196135771 X:112208145-112208167 CAAACTGCTATTAGCTGAAAAGG + Intergenic
1196327041 X:114418286-114418308 CAAAAATGTATTAGTTAAAAAGG + Intergenic
1197006671 X:121510657-121510679 GAAAATTCTAAGAGTTAAAAAGG + Intergenic
1197151371 X:123223517-123223539 TAGAATGCTAGTGGTTAAAAAGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197625704 X:128800126-128800148 CAAAATGCTCATATGCAAAAGGG - Intergenic
1198484582 X:137074215-137074237 CCAAATGCTAAATGTTGAAAAGG + Intergenic
1198626809 X:138584722-138584744 CAAAATGCTAATAATGCAAGCGG - Intergenic
1198929246 X:141836195-141836217 CAAAATGTCAATAGTAATAAAGG - Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199863474 X:151822433-151822455 CAAAATTCTAATATTTTTAAGGG + Intergenic
1200069440 X:153520517-153520539 AACAATGATAATAGTTATAATGG + Intronic
1200451237 Y:3331635-3331657 AAAAATGGAAATAATTAAAAAGG - Intergenic
1200610185 Y:5318653-5318675 CAAAATATAAATAGGTAAAAAGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1202057561 Y:20850871-20850893 CAAAATACCAATACTTCAAATGG - Intergenic
1202101216 Y:21310048-21310070 CAAAATGGCAATAGATTAAAGGG - Intergenic
1202187094 Y:22197206-22197228 CAAAATGGCAATAGATTAAAGGG - Intergenic
1202204266 Y:22389190-22389212 CAAAATGGCAATAGATTAAAGGG + Intronic