ID: 1102941708

View in Genome Browser
Species Human (GRCh38)
Location 12:116948156-116948178
Sequence TAGTTTAGCAAATCATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102941708_1102941713 26 Left 1102941708 12:116948156-116948178 CCTGGAAATGATTTGCTAAACTA 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1102941713 12:116948205-116948227 CCTAGTGTTTGCATAAATGCAGG 0: 1
1: 0
2: 3
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102941708 Original CRISPR TAGTTTAGCAAATCATTTCC AGG (reversed) Intronic
903076443 1:20771073-20771095 TAGTTTAATAAATCTTTTCTAGG - Exonic
903839574 1:26228793-26228815 TATTTTAGAAATTAATTTCCTGG + Intergenic
905305501 1:37015202-37015224 TGCTTTAGCACATCATCTCCAGG - Intronic
905572575 1:39017370-39017392 CAGTTTATCACATCATTTTCTGG - Intergenic
906450538 1:45942923-45942945 TACTTTAGGATAACATTTCCTGG + Intronic
907812842 1:57889474-57889496 TAGTTTTGCAAATCAGTGTCAGG - Intronic
908465355 1:64388173-64388195 TAGTTTTGCAAATCTTTTGGAGG - Intergenic
908724584 1:67162037-67162059 TATTTTATCAAATCATATCATGG - Intronic
910929260 1:92426509-92426531 TGCTTAAGGAAATCATTTCCTGG + Intergenic
911525020 1:98973992-98974014 TGGTGTAGTAAATCCTTTCCGGG + Intronic
911547569 1:99237978-99238000 AATTTCAGCAAATCCTTTCCCGG + Intergenic
913178382 1:116296154-116296176 TAGATTAGCAAATTATTTACTGG + Intergenic
913558585 1:119995183-119995205 TAGTTTGACAGATCCTTTCCTGG + Intronic
913639256 1:120795288-120795310 TAGTTTGACAGATCCTTTCCTGG - Intergenic
914279194 1:146154670-146154692 TAGTTTGACAGATCCTTTCCTGG + Intronic
914540237 1:148605600-148605622 TAGTTTGACAGATCCTTTCCTGG + Intronic
914626407 1:149465614-149465636 TAGTTTGACAGATCCTTTCCTGG - Intergenic
915732140 1:158061239-158061261 AAATTTAGCACCTCATTTCCTGG - Intronic
918754191 1:188316409-188316431 TAGTTTAGCAAAGCAACTCTAGG + Intergenic
924920655 1:248626098-248626120 TAGCTGAGCAGATCATCTCCAGG + Intergenic
1064372943 10:14769710-14769732 TAGTTTGGGAAATCATTTCTGGG - Intronic
1065073313 10:22050753-22050775 TAGTTAATCAAATAATTACCAGG + Intergenic
1068447706 10:57144234-57144256 TAGTTTAAAAAATAATTTTCTGG + Intergenic
1068892510 10:62162390-62162412 TAGTTTTGCAAAACATTTTTAGG + Intergenic
1069033498 10:63623632-63623654 TAGTTTACCATATTTTTTCCTGG + Exonic
1069245373 10:66198353-66198375 TAGTTTTGCAAATTCTTTCATGG + Intronic
1071068670 10:81667038-81667060 CAGTTTAGCAAATCCTTACTGGG - Intergenic
1071419433 10:85477031-85477053 TATTTTTGCAAATCATCTCTGGG - Intergenic
1073567554 10:104548096-104548118 CAGTTGAGCTACTCATTTCCTGG + Intergenic
1073873007 10:107887874-107887896 TAGTTTACCAACTCAGTTTCTGG + Intergenic
1075235177 10:120721408-120721430 CAGTTCAGCTAATCATTTACGGG - Intergenic
1080228604 11:29989644-29989666 TAGTTTAGCAAAACATTTTAAGG + Intergenic
1080898447 11:36465430-36465452 TGGATTGGCAACTCATTTCCTGG + Intergenic
1086031934 11:82370344-82370366 TACTGTAGCAAATAATTTCTCGG - Intergenic
1086500528 11:87448510-87448532 TAGCTAAGCAGATCAATTCCCGG + Intergenic
1086749753 11:90477107-90477129 TAATTTAACAAATCATTTGCTGG - Intergenic
1086879711 11:92138977-92138999 CAGTTTAGCATAACATCTCCGGG - Intergenic
1088125659 11:106420442-106420464 TATTTTTGCAAGTCACTTCCTGG + Intergenic
1088895664 11:114076559-114076581 TAATTTAGCAGATCATTTAGGGG - Intronic
1089558702 11:119332095-119332117 TAATTATGCAAATCATTTACAGG - Intergenic
1089872991 11:121693309-121693331 GAGTTCACCAAATTATTTCCTGG - Intergenic
1090569386 11:128030218-128030240 TAGTTTTGTGAATCATTTTCTGG - Intergenic
1092599893 12:10048885-10048907 TAGAATAGTAAATCCTTTCCAGG + Intronic
1094287411 12:28811111-28811133 TAGTTAAGGAAACCATTTGCGGG - Intergenic
1095330854 12:40961526-40961548 TAGTTCAGGAAATCATAACCTGG + Intronic
1098698887 12:73597288-73597310 TGGTTTAGTACATCCTTTCCTGG - Intergenic
1099244702 12:80180773-80180795 TAGTTTACCAAATAATTTTCAGG + Intergenic
1099294788 12:80816727-80816749 AAGTTTAGCAAATCAATGGCTGG + Intronic
1099464149 12:82962027-82962049 GAATTCAGCAAGTCATTTCCAGG - Intronic
1099654660 12:85474345-85474367 GATTTTAGAAAATCATTTACTGG + Intergenic
1100645330 12:96523208-96523230 TGGTTTCCCAAATCCTTTCCAGG - Intronic
1102941708 12:116948156-116948178 TAGTTTAGCAAATCATTTCCAGG - Intronic
1107121623 13:36802592-36802614 TTGTTTGAAAAATCATTTCCAGG + Intergenic
1107313989 13:39111359-39111381 AAATATAGCAAATGATTTCCAGG + Intergenic
1107636549 13:42398059-42398081 TACATTAACAAATCATTTCCAGG - Intergenic
1107759217 13:43658833-43658855 TAGTTTACCATATCATTTATTGG + Intronic
1112083228 13:95999667-95999689 TGGTTTAGCAAATCTTTTGGGGG - Intronic
1115252043 14:31359207-31359229 TAGTTGAGCCAGTCATTTCTAGG - Intronic
1115364011 14:32535822-32535844 AAGTTAAGCAATGCATTTCCAGG + Intronic
1117896089 14:60488489-60488511 TATCTTAACAAATCATTTTCTGG + Intronic
1119561533 14:75593811-75593833 TTTTTTAGCAAATGATTTCTTGG + Intronic
1119979912 14:79068605-79068627 TATTTTAGCATTTAATTTCCTGG + Intronic
1120562190 14:86008986-86009008 TAGTTAATTAAATAATTTCCTGG + Intergenic
1120662495 14:87267042-87267064 AAGATCAGCAATTCATTTCCAGG + Intergenic
1125187182 15:36944469-36944491 TAGTTTAGCAAAAGACTTCATGG + Intronic
1126840370 15:52711707-52711729 TATTTTAGCGAAAAATTTCCAGG - Intergenic
1129057208 15:72829060-72829082 TAGGTTAGGAAATCACTCCCAGG + Intergenic
1129062648 15:72872625-72872647 CATTTTAGAAAATCTTTTCCTGG + Intergenic
1132875970 16:2137530-2137552 TAGTTTAGAATTTCATTTCCAGG - Intergenic
1134474418 16:14560104-14560126 TATTTTATCAAATCATTCCAGGG - Intronic
1135095223 16:19559089-19559111 TAGTTGAGCAAAGCATTTAGTGG + Intronic
1135166259 16:20141724-20141746 AAGATTAGAAAATCCTTTCCAGG + Intergenic
1135262241 16:20990669-20990691 TAGTTTAGTAAATCATTATAAGG + Intronic
1135796095 16:25444331-25444353 TAGTTGAGAAAATCATTTCTGGG - Intergenic
1138283799 16:55792871-55792893 TAGTTTAAAAAATCCTTTCACGG + Intergenic
1138285203 16:55804116-55804138 TAGTTTAAAAAATCCTTTCACGG - Intronic
1139807130 16:69576507-69576529 AAAATTAGCAAATCATTGCCTGG + Intronic
1141340532 16:83199901-83199923 TGGTTTAGAAAATGATTTCTGGG - Intronic
1146204125 17:30887209-30887231 CAGTTAAGCAAATCATTTGTAGG - Exonic
1147714185 17:42493080-42493102 TTCTCTAGCAAATCATTTGCAGG + Intronic
1155406524 18:25494269-25494291 TAGAATGGCAAATCCTTTCCAGG - Intergenic
1156684697 18:39630721-39630743 GAGTTTAAAAAATCATTTCAAGG + Intergenic
1157722568 18:49936734-49936756 TAGTATAACAAATTATTTCCAGG - Intronic
1159698613 18:71593582-71593604 TAATTTAACAAATCACTTCCAGG + Intergenic
1159872715 18:73776556-73776578 TTGTTTAAGAAATCTTTTCCTGG - Intergenic
1163504124 19:17694644-17694666 TTGTTTAAGAAATCCTTTCCCGG + Intergenic
931919810 2:67002435-67002457 TAGTTGATCAATACATTTCCTGG - Intergenic
933405113 2:81848100-81848122 TTGTTTTCCAAACCATTTCCTGG - Intergenic
933867245 2:86531881-86531903 AAGTTTAACAACTCACTTCCTGG - Intronic
934881008 2:97978840-97978862 TAGAATGGCAAATCCTTTCCAGG + Intronic
937502101 2:122490397-122490419 TAGTTTTGCAGAGCATTGCCAGG + Intergenic
940213045 2:151275317-151275339 GAGTGTAGGAAATTATTTCCAGG - Intronic
940309521 2:152262803-152262825 TATTTTAGCAAGTCAGTTTCTGG - Intergenic
942253825 2:174071712-174071734 TTCTTTAGGAAATCACTTCCAGG - Intergenic
942833091 2:180260235-180260257 TAGATTGGTAAATCCTTTCCAGG + Intergenic
942956367 2:181778865-181778887 TAATTTCCCAAATCTTTTCCAGG - Intergenic
943534404 2:189129330-189129352 TTCTTTAGCAAATCATTTATGGG - Intronic
943535677 2:189146920-189146942 TAGTTTCACAAATCTTTTTCTGG - Intronic
944454875 2:199882958-199882980 TATGTTAGCAACACATTTCCTGG - Intergenic
944651354 2:201833436-201833458 AACTTTAGAATATCATTTCCAGG + Intronic
1168987964 20:2066785-2066807 CAGTTTAGCATTTCATTTCAAGG - Intergenic
1169242377 20:3995006-3995028 TAGTTTAGCAATTCATAGCCAGG + Intronic
1170681144 20:18526777-18526799 TATTTTTGAAAATGATTTCCAGG + Intronic
1170924138 20:20707449-20707471 TAATTTAGCTTACCATTTCCTGG - Intronic
1174872903 20:54200002-54200024 GAGGTTATCACATCATTTCCTGG - Intergenic
1175857454 20:62129954-62129976 TACTTGAACACATCATTTCCTGG + Intronic
1178662046 21:34515282-34515304 TGATTTAGCCACTCATTTCCAGG + Intronic
1179821882 21:43941796-43941818 AAGGGTATCAAATCATTTCCTGG + Intronic
1180230236 21:46422599-46422621 CAGTTTAGCAGATCATTTTATGG + Intronic
949796467 3:7856594-7856616 TATTTTAGAAACTGATTTCCGGG + Intergenic
951496150 3:23329050-23329072 TACTTTAGCAAATAAGATCCAGG - Intronic
951663845 3:25099961-25099983 TACTTTAAAATATCATTTCCTGG + Intergenic
952750995 3:36824774-36824796 TACTTTAGCAAATCACTTGTGGG - Intergenic
952999521 3:38919760-38919782 TAAATTAAAAAATCATTTCCTGG - Intronic
954584769 3:51723507-51723529 TAATTTAAAAAATTATTTCCAGG - Intergenic
955217879 3:56999517-56999539 TATTTTAGCAAATATTTTCCAGG + Intronic
956359268 3:68429205-68429227 TAGTTGAGAAGATCATTGCCAGG - Intronic
956948298 3:74249986-74250008 TATTTCAGCAAGTCATATCCTGG + Intergenic
958888751 3:99759417-99759439 TAGTTTAGGAAATCATTTCGAGG - Intronic
959884497 3:111483092-111483114 TAGTTGAGCATATCCTTTCAGGG + Intronic
962540434 3:136376335-136376357 TAGTTTACAAAATCATATCATGG + Intronic
962747659 3:138409429-138409451 TGGTTTAGCACATAATTGCCAGG - Intergenic
964937854 3:162115252-162115274 TTGTTTAGCTAATAATTTACTGG + Intergenic
965023387 3:163264799-163264821 TAGTTTTTCAAATCATTTTTTGG - Intergenic
965178352 3:165365687-165365709 TAGTTTGGAAAATCAGTTGCTGG - Intergenic
966327017 3:178768122-178768144 TATTTTAGCAAATATTTTCTAGG + Intronic
967197800 3:187043797-187043819 TAGATCTGCACATCATTTCCAGG + Intronic
968470568 4:780494-780516 TTGTTTTTTAAATCATTTCCAGG + Intergenic
968874447 4:3257976-3257998 TTGTTAAGCAAATGATTTCTTGG - Intronic
971065723 4:23030546-23030568 AGGTTTAGCAAATCATTATCAGG - Intergenic
971459733 4:26882160-26882182 TAGTTTAACACATCTTTTGCTGG - Intronic
971951843 4:33360755-33360777 TAGTTTAGAAACTTATTTACTGG - Intergenic
975929293 4:79499330-79499352 TTGTTTTGCAAATAATTTCCAGG - Intergenic
975980587 4:80153995-80154017 AAGGTCAGCAAATTATTTCCAGG - Intergenic
976287027 4:83380916-83380938 AAGTTCAGAAAATCCTTTCCAGG + Intergenic
976544379 4:86317733-86317755 TAGTATAGCAAATAATTTCCAGG - Intronic
977407245 4:96615597-96615619 TAGTTCAGTAAATAATTGCCAGG - Intergenic
978732588 4:112046918-112046940 TAGTTCAGCAATACATTTCCAGG - Intergenic
979715847 4:123836690-123836712 TACTTTTGAAAATAATTTCCAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982074561 4:151725631-151725653 TTGCTTAGCAAACCCTTTCCTGG - Intronic
983210273 4:164951539-164951561 CAGTTTACCAAATAATTTTCAGG - Intergenic
986793694 5:11188849-11188871 TAGTTTAACAGATCATTATCCGG + Intronic
987188267 5:15446719-15446741 TAGTTCAGAAAGTCATTTTCTGG - Intergenic
991163122 5:63528680-63528702 TAAATCAGAAAATCATTTCCAGG - Intergenic
991287572 5:64995526-64995548 TAATAAAGCAAATCAATTCCAGG - Intronic
992384989 5:76276264-76276286 TAGTTTTACAAAGCATTTGCAGG + Intronic
994121880 5:96123609-96123631 TAGATTAGCAAAACAGTTGCTGG + Intergenic
995017780 5:107331223-107331245 TAGTTTAGCAAATTATATATTGG - Intergenic
995260804 5:110102344-110102366 TAGGTTAGCAATTCACTCCCAGG - Intergenic
995462193 5:112415544-112415566 TTGGTTAGCAAAACATTTTCAGG - Intronic
996566454 5:124884256-124884278 TCGTTTATGTAATCATTTCCAGG - Intergenic
999653409 5:153789595-153789617 TAGTCTGTAAAATCATTTCCAGG + Intronic
1000929894 5:167238913-167238935 TGCTTTAGCAAAGCCTTTCCTGG + Intergenic
1001235144 5:170022933-170022955 TAGTTTATAAAAACATTTGCTGG - Intronic
1003169145 6:3707279-3707301 TTGTTTAGCATAACATTTTCAGG - Intergenic
1003391905 6:5721207-5721229 TATTTTTGCAAATCTTTTTCGGG + Intronic
1004264329 6:14135722-14135744 ATATTTAGCAAATAATTTCCTGG + Exonic
1005614575 6:27560335-27560357 ATATTTAGCAAATAATTTCCTGG - Intergenic
1005701767 6:28408617-28408639 TTTTTCAGAAAATCATTTCCAGG + Intergenic
1005717735 6:28567533-28567555 CATTTTAGCAAAGCTTTTCCAGG - Intergenic
1008192035 6:48471409-48471431 AAGTGTAGCAGATGATTTCCTGG + Intergenic
1008517241 6:52329589-52329611 TAATTTTGCATATCATTTCAGGG + Intergenic
1009765338 6:68066306-68066328 TGGTTTAGTAAGTCATTTCATGG - Intergenic
1010702990 6:79074979-79075001 TAATACAACAAATCATTTCCAGG + Intronic
1011146056 6:84218177-84218199 TAGTTCACCTAATTATTTCCTGG - Intronic
1014165399 6:118218787-118218809 TAGTTTACCAATACATTTCCAGG - Intronic
1014927380 6:127289487-127289509 TATTTTGGTAAATTATTTCCAGG + Exonic
1021648539 7:22810202-22810224 TTGTTTAGAAAATAATATCCTGG + Intergenic
1027869949 7:83694325-83694347 AAGCTTTGCAAACCATTTCCAGG - Intergenic
1029816753 7:103104796-103104818 TAATTTAGGAAATTATTTCAGGG - Intronic
1030549666 7:110942617-110942639 CAGTTTAGCTCATCAGTTCCAGG + Intronic
1031547763 7:123070546-123070568 TAATTTAACAAATTAATTCCAGG + Intergenic
1032126664 7:129200119-129200141 AGGTTTAAAAAATCATTTCCTGG + Intronic
1033304104 7:140211751-140211773 TAATTTAGCAAATCAAATACAGG - Intergenic
1033474732 7:141680979-141681001 TACTGTAGTAACTCATTTCCAGG - Intronic
1034951796 7:155303006-155303028 TAATTTAGCAAAGAATTACCTGG - Intronic
1038394056 8:27233637-27233659 CATTTTAGCAAGTCATTCCCCGG - Intergenic
1040619867 8:49079425-49079447 TAGTTTAGAGAATTATTTCAAGG - Intergenic
1042113545 8:65407367-65407389 TAATCTTGCATATCATTTCCAGG + Intergenic
1044543860 8:93437196-93437218 TGTTTTAGCAAATCATGGCCTGG + Intergenic
1045218270 8:100171227-100171249 AATTTTAGCAAATCAAATCCAGG - Intronic
1045590956 8:103597025-103597047 TTGTTATCCAAATCATTTCCTGG - Intronic
1046681565 8:117176366-117176388 GAGCTGAGAAAATCATTTCCTGG - Intronic
1046834495 8:118784599-118784621 AAGATTAGCAATGCATTTCCTGG + Intergenic
1047635078 8:126752813-126752835 TAGGCTAGCGAATAATTTCCAGG - Intergenic
1050772685 9:9222241-9222263 AAGTTTAGCAAACAACTTCCAGG + Intronic
1050853509 9:10320388-10320410 TAATTTAGCAAATCTTGGCCAGG + Intronic
1051099375 9:13503443-13503465 TAGTTTTGCAAATAATTTACAGG - Intergenic
1051535708 9:18155230-18155252 TAGTAAATTAAATCATTTCCTGG - Intergenic
1053563420 9:39220852-39220874 TGGTCTAGGAAATCATTTTCTGG - Intronic
1053829206 9:42058773-42058795 TGGTCTAGGAAATCATTTTCTGG - Intronic
1054133727 9:61398214-61398236 TGGTCTAGGAAATCATTTTCTGG + Intergenic
1054601353 9:67128674-67128696 TGGTCTAGGAAATCATTTTCTGG + Intergenic
1058951857 9:109911331-109911353 CCGTGTAGGAAATCATTTCCAGG - Intronic
1060327690 9:122633382-122633404 TAGTTTTGGCAATCATTTTCTGG + Intergenic
1060921921 9:127426646-127426668 TCGCTTAGCACATCATTTTCAGG + Intronic
1061940222 9:133879996-133880018 TGGTTTAGAAAATCTTTTCTGGG - Intronic
1186096013 X:6102594-6102616 TAGTTCAGCAAATTACTTACAGG - Intronic
1188365882 X:29314538-29314560 TAGTTTACAACATTATTTCCTGG + Intronic
1189112997 X:38312963-38312985 AAATTTAGCATATCATTTCAGGG + Intronic
1189666763 X:43364002-43364024 TTTTTTAGCAAAGCCTTTCCTGG + Intergenic
1195141345 X:101963630-101963652 TGGTTTATCAAATCTTTTCATGG - Intergenic
1197776039 X:130119372-130119394 TAGTTTATCAGATCCTCTCCTGG + Intergenic
1199472851 X:148213727-148213749 TATCTTAGCATGTCATTTCCAGG + Intergenic
1199705742 X:150423307-150423329 TTGTTTTTAAAATCATTTCCAGG + Intronic
1201311162 Y:12599039-12599061 CAATTTAGCAAAACAATTCCAGG - Intergenic