ID: 1102941958

View in Genome Browser
Species Human (GRCh38)
Location 12:116950856-116950878
Sequence CACCAAACTGTAGCATCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 668}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102941958_1102941963 16 Left 1102941958 12:116950856-116950878 CCCACGGATGCTACAGTTTGGTG 0: 1
1: 0
2: 4
3: 33
4: 668
Right 1102941963 12:116950895-116950917 CTTAGATCATTCCAGCTTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 105
1102941958_1102941964 17 Left 1102941958 12:116950856-116950878 CCCACGGATGCTACAGTTTGGTG 0: 1
1: 0
2: 4
3: 33
4: 668
Right 1102941964 12:116950896-116950918 TTAGATCATTCCAGCTTAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 154
1102941958_1102941961 -9 Left 1102941958 12:116950856-116950878 CCCACGGATGCTACAGTTTGGTG 0: 1
1: 0
2: 4
3: 33
4: 668
Right 1102941961 12:116950870-116950892 AGTTTGGTGTGAACTCCGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102941958 Original CRISPR CACCAAACTGTAGCATCCGT GGG (reversed) Intronic
900014686 1:139787-139809 CACCATAATGTAGAATCAGTGGG + Intergenic
900044951 1:498396-498418 CACCATAATGTAGAATCAGTGGG + Intergenic
900066354 1:733304-733326 CACCATAATGTAGAATCAGTGGG + Intergenic
900066751 1:736710-736732 CACCATAATGTAGAATCAGTGGG + Intergenic
900067149 1:740126-740148 CACCATAATGTAGAATCAGTGGG + Intergenic
900587245 1:3439227-3439249 CACCATAGTGTACAATCCGTGGG + Intergenic
901079148 1:6573998-6574020 CACCATAATGTAGAATCAGTGGG + Intronic
901557740 1:10044942-10044964 CACCATAATGTAGAATCAGTGGG + Intronic
902800689 1:18827874-18827896 CACCATAATGTAGAATCAGTGGG - Intergenic
903434399 1:23335720-23335742 CACCATAATGTAGAATCAGTGGG - Intronic
904165164 1:28549792-28549814 CACCATAATGTAGAATCAGTGGG + Intergenic
904353060 1:29921494-29921516 CACCATAATGTAGAATCAGTGGG + Intergenic
904435336 1:30491321-30491343 CACCATAATGTAGAATCAGTGGG + Intergenic
907150811 1:52285665-52285687 CACCATAATGTAGAATCAGTGGG - Intronic
907683455 1:56586481-56586503 CACCATAATGTAGAATCAGTGGG + Intronic
907788289 1:57635594-57635616 CACCATAATGTAGAATCAGTGGG - Intronic
907926091 1:58956423-58956445 CACCATAATGTAGAATCAGTGGG - Intergenic
908413067 1:63885961-63885983 CACCATAATGTAGAATCGGTGGG + Intronic
908949956 1:69548348-69548370 CACCATAATGTAGAATCAGTGGG - Intergenic
909617372 1:77626377-77626399 CACCATAATGTAGAATCAGTGGG + Intronic
910209534 1:84778955-84778977 CACCATAATGTAGAATCAGTGGG - Intergenic
910222175 1:84898719-84898741 CACCATAATGTAGAATCAGTGGG + Intergenic
910254120 1:85230185-85230207 CACCATAATGTAGAATCAGTGGG - Intergenic
910485220 1:87705633-87705655 CACCATAATGTAGAATCAGTGGG - Intergenic
911147042 1:94562485-94562507 CACCATAATGTAGCATCAGTGGG + Intergenic
912672845 1:111647327-111647349 CACCATACTGTAGAATCAGTGGG - Intronic
912904504 1:113689720-113689742 CACCATAATGTAGAATCAGTGGG + Intergenic
913528813 1:119718435-119718457 AACCAAACTGTAAAATCCCTTGG - Intronic
916333955 1:163648998-163649020 CACCATAATGTAGAATCAGTAGG - Intergenic
916346501 1:163797625-163797647 CACCATAATGTAGAATCAGTGGG - Intergenic
916629921 1:166601347-166601369 CACCATAATGTAGAATCAGTGGG + Intergenic
917582531 1:176393372-176393394 CACCATAATGTAGAATCAGTGGG + Intergenic
917778217 1:178361809-178361831 CACCATAATGTAGAATCAGTGGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918445683 1:184614659-184614681 CACCATAATGTAGAATCAGTGGG + Intronic
918502839 1:185217537-185217559 CACCATAATGTAGAATCAGTGGG - Intronic
918524816 1:185453777-185453799 CACCATAATGTAGAATCAGTGGG - Intergenic
920580138 1:207098707-207098729 CACCATAATGTAGAATCAGTGGG + Intronic
921322431 1:213955020-213955042 CACCATAATGTAGAATCAGTGGG + Intergenic
921402306 1:214738832-214738854 CACCATAATGTAGAATCAGTGGG + Intergenic
921425297 1:214994376-214994398 CACCATAATGTAGAATCAGTTGG - Intergenic
922101080 1:222477244-222477266 CACCATAATGTAGAATCAGTGGG + Intergenic
922164691 1:223105537-223105559 CACCACAATGTAGAATCAGTGGG + Intergenic
922262180 1:223952382-223952404 CACCATAATGTAGAATCAGTGGG + Intergenic
922329391 1:224560725-224560747 CACCATAATGTAGAATCCGTGGG - Intronic
922501676 1:226101472-226101494 CACCATAATGTAGAATCAGTGGG - Intergenic
922733539 1:227967428-227967450 CACCATAATGTAGAATCAGTGGG - Intergenic
923230249 1:231979206-231979228 CACCATAATGTAGAATCAGTGGG - Intronic
923377339 1:233377772-233377794 CACCATAATGTAGAATCAGTGGG + Intronic
924344005 1:243057361-243057383 CACCATAATGTAGAATCAGTGGG + Intergenic
924375505 1:243403800-243403822 CACCATAATGTAGAATCAGTGGG - Intronic
924713925 1:246554612-246554634 CACCATAATGTAGAATCAGTGGG - Intronic
924821756 1:247498847-247498869 CACCATAATGTAGAATCAGTGGG + Intergenic
1064115791 10:12576508-12576530 CACCATGATGTAGCATCAGTGGG + Intronic
1064204427 10:13311219-13311241 CACCATAATGTAGAATCAGTGGG - Intergenic
1064218278 10:13418381-13418403 CACCATAATGTAGAATCAGTGGG - Intergenic
1064513445 10:16120483-16120505 CACCATAATGTAGAATCAGTGGG - Intergenic
1064750366 10:18522219-18522241 CACCATAATGTAGAATCAGTGGG - Intronic
1065505840 10:26429353-26429375 CACCATAATGTAGAATCAGTGGG - Intergenic
1065672555 10:28136187-28136209 CACCATAATGTAGGATCAGTGGG - Intronic
1065795046 10:29298955-29298977 CACCATAATGTAGAATCAGTGGG + Intronic
1065931571 10:30483863-30483885 CACCATAATGTAGAATCAGTGGG - Intergenic
1065947846 10:30623713-30623735 CACCATAATGTAGAATCAGTGGG - Intronic
1066127374 10:32354967-32354989 CACCATAATGTAGAATCAGTGGG - Intronic
1066732327 10:38447702-38447724 CACCATAATGTAGAATCAGTGGG - Intergenic
1067393815 10:45892425-45892447 CACCTACCTGTAGCATGCCTCGG + Intergenic
1067420551 10:46141806-46141828 CACCATAATGTAGAATCAGTGGG - Intergenic
1067425470 10:46207727-46207749 CACCATAATGTAGAATCAGTGGG + Intergenic
1067505894 10:46848272-46848294 CACCATAATGTAGAATCAGTGGG - Intergenic
1067862139 10:49861581-49861603 CACCTACCTGTAGCATGCCTTGG + Exonic
1068544259 10:58328217-58328239 CACCACAATGTAGAATCAGTGGG + Intergenic
1068610633 10:59056444-59056466 CACCATAATGTAGAATCAGTGGG - Intergenic
1068816132 10:61315407-61315429 CTCCAAATTTTAGCATCCTTTGG - Intergenic
1068819680 10:61359874-61359896 CACCATAATGTAGAATCAGTAGG - Intergenic
1069358433 10:67614396-67614418 CACCATAATGTAGAATCAGTGGG + Intronic
1069372277 10:67760882-67760904 CACCATAATGTAGAATCAGTGGG - Intergenic
1069795797 10:71050997-71051019 CTGCAAACTGCAGCATCCCTGGG + Intergenic
1070079928 10:73176059-73176081 CACCATAATGTAGAATCAGTGGG + Intronic
1070097824 10:73355450-73355472 CACCATAATGTAGAATCAGTGGG - Intronic
1070222444 10:74463315-74463337 CACCATAATGTAGAATCAGTGGG + Intronic
1070615257 10:77964700-77964722 CACCATAATGTAGAATCAGTGGG - Intergenic
1070798914 10:79233616-79233638 CCCCAAACCGTAGCATCCACAGG + Intronic
1071866580 10:89741065-89741087 CACCATAATGTAGAATCAGTGGG + Intronic
1071909137 10:90211192-90211214 CACCATAATGTAGAATCAGTGGG + Intergenic
1072584339 10:96768099-96768121 CACCATAATGTAGAATCCTTCGG + Intergenic
1072858976 10:98983237-98983259 CACCATAATGTAGAATCAGTGGG + Intronic
1073188799 10:101635294-101635316 CACCATAATGTAGAATCAGTGGG - Intronic
1073232353 10:101982833-101982855 CACCATAATGTAGAATCAGTGGG - Intronic
1073659969 10:105463985-105464007 CACCATAATGTAGAATCAGTGGG - Intergenic
1073699237 10:105906933-105906955 CACCATAATGTAGAATCAGTGGG - Intergenic
1073740311 10:106398972-106398994 CACCATAATGTAGAATCAGTGGG - Intergenic
1074610221 10:115014684-115014706 CACCATAATGTAGAATCAGTGGG + Intergenic
1074729074 10:116349202-116349224 CACCATAATGTAGAATCAGTGGG - Intronic
1074744011 10:116513417-116513439 CACCATAATGTAGAATCAGTGGG + Intergenic
1075013198 10:118892200-118892222 CACCATAATGTAGAATCAGTGGG + Intergenic
1075205493 10:120444323-120444345 CACCATAATGTAGAATCAGTGGG - Intergenic
1075307834 10:121383575-121383597 CACCATAATGTAGAATCAGTGGG + Intergenic
1075929411 10:126282973-126282995 CACCATAATGTAGCATCAGTGGG + Intronic
1076357740 10:129865248-129865270 CAACAAAGTGCAGCATCTGTAGG - Intronic
1076450452 10:130553726-130553748 CACCATAATGTAGAATCAGTGGG + Intergenic
1076970882 11:131464-131486 CACCATAATGTAGAATCAGTGGG + Intergenic
1076971280 11:134887-134909 CACCATAATGTAGAATCAGTGGG + Intergenic
1077585107 11:3445500-3445522 CACCATAATGTAGAATCAGTGGG + Intergenic
1077901592 11:6494360-6494382 CACCATAATGTAGAATCAGTGGG - Intronic
1078625903 11:12957909-12957931 CACCATAATGTAGAATCAGTGGG - Intergenic
1079713218 11:23712390-23712412 CACCATAATGTAGAATCAGTGGG - Intergenic
1080739861 11:35053627-35053649 CACCATAATGTAGAATCAGTGGG - Intergenic
1080878533 11:36298369-36298391 CACCACAGTGTAGAATCAGTGGG + Intronic
1080903142 11:36514557-36514579 CACCATAATGTAGAATCAGTGGG + Intronic
1080954509 11:37077806-37077828 CACCATAATGTAGAATCAGTGGG + Intergenic
1081263607 11:40991588-40991610 CACCAAAATGTAGAATCAGTGGG + Intronic
1081475083 11:43421729-43421751 CACCACAATGTAGAATCAGTGGG - Intronic
1081480624 11:43485038-43485060 CACCATAATGTAGAATCAGTGGG - Intronic
1081972171 11:47206958-47206980 CAGCAATCTTTAGCATCCCTTGG - Intergenic
1082263777 11:50098071-50098093 CACCATAATGTAGAATCAGTGGG + Intergenic
1082769921 11:57199882-57199904 CACCAAATTGTAGGATCAGTGGG - Intergenic
1083703999 11:64500637-64500659 CACCATAATGTAGAATCAGTAGG + Intergenic
1084217173 11:67654489-67654511 TAGCAAACTGTAGCATCTGGTGG - Intergenic
1084242010 11:67828075-67828097 CACCATAATGTAGAATCAGTGGG + Intergenic
1084401937 11:68949300-68949322 CACCATAATGTAGAATCAGTGGG - Intergenic
1084932364 11:72567232-72567254 CACCAGAATGTAGAATCAGTGGG + Intergenic
1085219519 11:74861546-74861568 CACCACAGTGTAGAATCAGTGGG - Intronic
1087146730 11:94820682-94820704 CACCATAATGTAGAATCAGTAGG + Intronic
1088482102 11:110304000-110304022 CACCATAATGTAGAATCAGTGGG - Intergenic
1089052655 11:115559044-115559066 CACCATAATGTAGAATCAGTGGG - Intergenic
1089151148 11:116365337-116365359 CACCATAATGTAGAATCAGTGGG - Intergenic
1089181382 11:116585283-116585305 CACCATAATGTAGAATCAGTGGG - Intergenic
1089718103 11:120383455-120383477 CACCATAATGTAGAATCAGTGGG + Intronic
1090321268 11:125845365-125845387 CAGCAAACTGCAGCAGCCCTGGG + Intergenic
1090704840 11:129326792-129326814 CACCATAGTGTAGAATCAGTGGG + Intergenic
1091479699 12:814850-814872 CACCATAATGTAGAATCAGTGGG + Intronic
1091541622 12:1467717-1467739 CACCATAATGTAGAATCCATGGG + Intronic
1092194951 12:6543603-6543625 CACCATAATGTAGAATCAGTGGG - Intronic
1092412252 12:8262766-8262788 CACCATAATGTAGAATCAGTGGG + Intergenic
1092567874 12:9687173-9687195 CACCATAATGTAGAATCAGTGGG + Intronic
1092590206 12:9946363-9946385 CACCATAATGTAGAATCAGTGGG - Intergenic
1092805375 12:12217383-12217405 CACCATAATGTAGAATCAGTAGG - Intronic
1093104443 12:15068979-15069001 CACCATAATGTAGAATCAGTGGG - Intergenic
1093245931 12:16736556-16736578 CACCATAATGTAGAATCAGTGGG - Intergenic
1094416034 12:30216005-30216027 CACCATAATGTAGAATCAGTGGG + Intergenic
1094812796 12:34156301-34156323 CACCATAATGTAGAATCAGTGGG - Intergenic
1095183612 12:39175547-39175569 CACCATAATGTAGAATCAGTGGG - Intergenic
1096403820 12:51328296-51328318 CACCATAATGTAGAATCAGTGGG + Intergenic
1096728309 12:53583439-53583461 CACCATAATGTAGAATCAGTGGG - Intronic
1097308118 12:58091165-58091187 CACCATAATGTAGAATCAGTGGG + Intergenic
1097742861 12:63265041-63265063 CACCATAATGTAGAATCAGTAGG - Intergenic
1098663953 12:73136350-73136372 CACCATAATGTAGAATCAGTGGG + Intergenic
1098937126 12:76492757-76492779 CACCATAATGTAGAATCAGTGGG - Intronic
1099317810 12:81106408-81106430 CACCATAATGTAGAATCAGTGGG - Intronic
1099338639 12:81398000-81398022 CACCATAATGTAGAATCAGTGGG - Intronic
1099748000 12:86732432-86732454 CACCATAATGTAGAATCAGTGGG + Intronic
1100173948 12:92008242-92008264 CACCATAATGTAGAATCAGTGGG - Intronic
1100177801 12:92050768-92050790 CACCATAATGTAGAATCAGTGGG + Intronic
1100230862 12:92605571-92605593 CACCATAATGTAGAATCAGTGGG - Intergenic
1100424353 12:94469505-94469527 CACCATAATGTAGAATCAGTGGG + Intergenic
1100724611 12:97395632-97395654 CACCATAATGTAGAATCAGTGGG + Intergenic
1100735593 12:97526067-97526089 CACCATAATGTAGAATCAGTGGG - Intergenic
1101182481 12:102234355-102234377 CACCATAATGTAGAATCAGTAGG - Intergenic
1101373414 12:104150820-104150842 CACCATAATGTAGAATCAGTGGG - Intergenic
1101539597 12:105653078-105653100 CACCATAATGTAGAATCAGTGGG + Intergenic
1101819065 12:108169211-108169233 CACCACAATGTAGAATCAGTGGG - Intronic
1102391053 12:112548981-112549003 CACCATAATGTAGAATCAGTGGG + Intergenic
1102941958 12:116950856-116950878 CACCAAACTGTAGCATCCGTGGG - Intronic
1103865379 12:124047622-124047644 CACCATAATGTAGAATCAGTGGG - Intronic
1104023387 12:125008799-125008821 CACCATAATGTAGAATCAGTGGG + Intronic
1104538513 12:129641017-129641039 CACCATAATGTAGAATCAGTGGG - Intronic
1105786682 13:23757087-23757109 CACCATAATGTAGAATCAGTGGG + Intronic
1105970750 13:25427361-25427383 CACCATAATGTAGAATCAGTGGG - Intronic
1105983970 13:25547551-25547573 CACCATAATGTAGAATCAGTGGG - Intronic
1106985554 13:35343829-35343851 CACCATAATGTAGAATCAGTGGG - Intronic
1107593612 13:41937312-41937334 CACCATAATGTAGAATCAGTGGG + Intronic
1107895359 13:44956514-44956536 CACCATAATGTAGAATCAGTAGG + Intronic
1108345877 13:49546558-49546580 CACCATAATGTAGAATCAGTGGG + Intronic
1109240757 13:59884292-59884314 CACCATAATGTAGAATCAGTGGG - Intronic
1109837108 13:67874507-67874529 CACCATAATGTAGAATCAGTGGG - Intergenic
1110388397 13:74942206-74942228 CAGCAAACTGGAGCAACTGTAGG - Intergenic
1110552433 13:76824572-76824594 CACCATAATGTAGGATCAGTGGG + Intergenic
1111183713 13:84701417-84701439 CACCATAATGTAGAATCAGTGGG + Intergenic
1111454665 13:88465271-88465293 CACCATAATGTAGAATCAGTGGG - Intergenic
1111694119 13:91601756-91601778 CACCATAATGTAGAATCAGTGGG - Intronic
1112410284 13:99157031-99157053 CACCATAATGTAGAATCAGTGGG + Intergenic
1113401457 13:109997805-109997827 CACCATAATGTAGTATCAGTGGG - Intergenic
1113658359 13:112085691-112085713 CACCAGAATGTAGAATCAGTGGG + Intergenic
1114058419 14:18996711-18996733 CACCAAAATGTAGAATCCGTGGG - Intronic
1114104127 14:19405043-19405065 CACCAAAATGTAGAATCCGTGGG + Intronic
1115179168 14:30602335-30602357 TACCAAACTGCATCATACGTGGG + Intronic
1115457294 14:33618324-33618346 CACCATAATGTAGAATCAGTGGG + Intronic
1115739828 14:36376479-36376501 CACCATAATGTAGTATCAGTGGG + Intergenic
1116140364 14:40985787-40985809 CACCAAAATGTAGAATCAGTGGG + Intergenic
1116200325 14:41785687-41785709 CACCATAATGTAGAATCGGTGGG + Intronic
1116522435 14:45866667-45866689 CACCATAATGTAGAATCAGTGGG + Intergenic
1116982510 14:51186495-51186517 CACCATAATGTAGAATCAGTGGG - Intergenic
1116992438 14:51290573-51290595 CACCATAATGTAGAATCAGTGGG + Intergenic
1117851527 14:59976178-59976200 CACCATAATGTAGAATCAGTGGG - Intronic
1118835210 14:69473075-69473097 CACCATAATGTAGAATCAGTGGG - Intergenic
1119454439 14:74742627-74742649 CACCATAATGTAGAATCAGTGGG + Intergenic
1120680634 14:87477076-87477098 CACCATAATGTAGAATCAGTGGG + Intergenic
1120685689 14:87533947-87533969 CACCATAATGTAGAATCAGTGGG - Intergenic
1120810963 14:88803028-88803050 CACCATAATGTAGAATCAGTGGG - Intergenic
1121170633 14:91851031-91851053 CACCATAATGTAGAATCAGTGGG - Intronic
1121539785 14:94716686-94716708 CACCATAATGTAGAATCAGTGGG - Intergenic
1122305471 14:100763383-100763405 CACCATAATGTAGAATCAGTGGG + Intergenic
1122472701 14:101982263-101982285 CACCATAATGTAGAATCTGTGGG - Intronic
1123965584 15:25453679-25453701 CACCATAATGTAGAATCAGTGGG - Intergenic
1124162751 15:27288357-27288379 CACCATAATGTAGAATCAGTGGG + Intronic
1124413500 15:29455979-29456001 CACCATAATGTAGAATCAGTGGG - Intronic
1124440260 15:29680603-29680625 CACCATAATGTAGAATCAGTGGG + Intergenic
1124450088 15:29780236-29780258 CACCATATTGTAGAATCAGTGGG + Intronic
1125135215 15:36333297-36333319 CACCATAATGTAGAATCAGTGGG - Intergenic
1125375905 15:39029084-39029106 CACCATAATGTAGGATCAGTGGG - Intergenic
1125750163 15:42022467-42022489 CACCATAATGTAGAATCAGTGGG + Intronic
1125752544 15:42038376-42038398 CACCATAATGTAGAATCAGTGGG + Intronic
1125860762 15:42997310-42997332 CACCATAATGTAGAATCAGTGGG - Intronic
1125979534 15:43987891-43987913 CACCATAATGTAGAATCAGTGGG + Intronic
1127063578 15:55213801-55213823 CACCATAATGTAGAATCAGTGGG - Intronic
1127160733 15:56182091-56182113 CACCATAATGTAGAATCAGTGGG - Intronic
1127565824 15:60187172-60187194 CACCATAATGTAGAATCAGTGGG - Intergenic
1127681503 15:61302696-61302718 CACCATAATGTAGAATCAGTGGG - Intergenic
1127809460 15:62550961-62550983 CACCATAATGTAGAATCAGTGGG + Intronic
1128014843 15:64334511-64334533 CACCATAATGTAGAATCAGTGGG + Intronic
1130743143 15:86622843-86622865 CACCATAATGTAGAATCAGTGGG + Intronic
1130940907 15:88508151-88508173 CACCATAATGTAGAATCAGTGGG - Intergenic
1131473512 15:92716505-92716527 AACAAAAGTGTAGCATCCCTAGG + Intronic
1132164693 15:99574452-99574474 CACCATAATGTAGAATCAGTGGG + Intronic
1133353518 16:5118992-5119014 CACCATAATGTAGAATCAGTGGG + Intergenic
1133581799 16:7151700-7151722 CACCATAATGTAGAATCAGTGGG + Intronic
1134256632 16:12617723-12617745 CACCATAATGTAGAATCAGTGGG - Intergenic
1134647414 16:15880960-15880982 CACCATAATGTAGAATCAGTGGG - Intronic
1134901485 16:17942078-17942100 CACCATAATGTAGAATCAGTAGG + Intergenic
1136567299 16:31078045-31078067 CACATATCTGTAGCATCTGTGGG + Exonic
1137306241 16:47203457-47203479 CACCATAATGTAGAATCAGTGGG + Intronic
1138019624 16:53466453-53466475 CACCAAAATGTAGAGTCAGTGGG + Intronic
1138109527 16:54312472-54312494 CACCATAATGTAGAATCAGTGGG + Intergenic
1138134430 16:54509301-54509323 CACCAAAGTGCACCATCCGAGGG - Intergenic
1138334615 16:56243153-56243175 CACCATAATGTAGAATCAGTGGG - Intronic
1138420467 16:56895797-56895819 CACCATAATGTAGAATCAGTGGG + Intronic
1138480209 16:57297750-57297772 CACCATAATGTAGAATCAGTGGG + Intergenic
1138914540 16:61447491-61447513 CACCATAATGTAGAATCAGTGGG + Intergenic
1140550619 16:75861844-75861866 CAGGAAACTGTAGCTTCCCTCGG - Intergenic
1141303869 16:82842750-82842772 CACCAGAGTGTAGAATCAGTGGG + Intronic
1141324435 16:83042487-83042509 CACCATAATGTAGAATCCATGGG - Intronic
1142116803 16:88361021-88361043 CACCATAATGTAGAATCAGTAGG + Intergenic
1142435070 16:90051392-90051414 CACCATAATGTAGAATCAGTGGG - Intergenic
1142448974 16:90162635-90162657 CACCATAATGTAGAATCAGTGGG - Intergenic
1142457721 17:65827-65849 CACCATAATGTAGAATCAGTGGG + Intergenic
1142458122 17:69247-69269 CACCATAATGTAGAATCAGTGGG + Intergenic
1143083948 17:4401876-4401898 CACCATAATGTAGAATCAGTGGG - Intergenic
1143203071 17:5125253-5125275 CACCATAATGTAGAATCAGTGGG - Exonic
1144582678 17:16468393-16468415 CACCATGCTGTAGCATGTGTTGG - Intronic
1145009734 17:19361186-19361208 CACCATAATGTAGAATCAGTGGG - Intronic
1146168453 17:30612255-30612277 CACCATAATGTAGAATCAGTGGG + Intergenic
1146470993 17:33124807-33124829 CACCATAATGTAGAATCAGTGGG + Intronic
1146689403 17:34862832-34862854 CACCATAGTGTAGAATCAGTGGG - Intergenic
1146837040 17:36119326-36119348 CACCATAATGTAGAATCAGTGGG - Intergenic
1147686827 17:42291032-42291054 CACCACAATGTAGGATCAGTGGG + Intronic
1148294397 17:46488325-46488347 CACCATAATGTAGCATCAGTGGG - Intergenic
1148316580 17:46706039-46706061 CACCATAATGTAGCATCAGTGGG - Intronic
1148531576 17:48398412-48398434 CACCATAATGTAGAATCAGTGGG - Intronic
1149360429 17:55889317-55889339 CACCATAATGTAGAATCAGTGGG - Intergenic
1149440355 17:56668763-56668785 CACCATAATGTAGAATCAGTGGG - Intergenic
1149897585 17:60441030-60441052 CACCATAATGTAGAATCAGTGGG + Intergenic
1149927697 17:60717878-60717900 CACCATAATGTAGAATCAGTGGG + Intronic
1150307289 17:64096434-64096456 CACCATAATGTAGAATCAGTAGG - Intronic
1150368530 17:64613866-64613888 CACCATAATGTAGAATCAGTGGG + Intronic
1150417754 17:65001234-65001256 CACCATAATGTAGAATCAGTGGG - Intergenic
1150455836 17:65305755-65305777 CACCAGAATGTAGAATCAGTGGG + Intergenic
1150793898 17:68222561-68222583 CACCATAATGTAGAATCAGTGGG + Intergenic
1150905134 17:69328400-69328422 CACCATAATGTAGAATCAGTGGG + Intergenic
1151019591 17:70599911-70599933 CACCATAATGTAGAATCAGTGGG + Intergenic
1151331661 17:73413344-73413366 CACCACAATGTAGAATCCATGGG - Intronic
1151506087 17:74528128-74528150 CACCATAATGTAGAATCAGTGGG - Intronic
1151945494 17:77317608-77317630 CACCATAATGTAGAATCAGTTGG - Intronic
1153013484 18:562321-562343 CACCATAATGTAGAATCAGTGGG - Intergenic
1153262485 18:3238094-3238116 CACCATAATGTAGAATCAGTGGG + Intergenic
1153533822 18:6078816-6078838 CACCATAATGTAGAATCAGTGGG + Intronic
1153845244 18:9043488-9043510 CACCATAATGTAGAATCAGTGGG - Intergenic
1154019174 18:10647711-10647733 CCCCAAACTGTAGCTTCCCTTGG + Intergenic
1154143037 18:11842479-11842501 CACCATAATGTAGAATCAGTGGG + Intronic
1154379264 18:13835169-13835191 CACCATAATGTAGAATCAGTGGG + Intergenic
1155112260 18:22727655-22727677 CACCATAATGTAGAATCAGTGGG - Intergenic
1155299573 18:24417181-24417203 CACCATAATGTAGAATCAGTGGG + Intergenic
1155668747 18:28343974-28343996 CACCATAATGTAGAATCAGTGGG + Intergenic
1155914219 18:31540057-31540079 CACCATAATGTAGAATCAGTGGG - Intronic
1155991039 18:32279588-32279610 CACCATAATGTAGAATCAGTGGG - Intronic
1156009607 18:32481397-32481419 CACCATAATGTAGAATCAGTGGG + Intergenic
1156679684 18:39573324-39573346 CACCACATTGTAGTATCCGGAGG + Intergenic
1157715574 18:49884409-49884431 CACCATAATGTAGAATCAGTGGG + Intronic
1157768999 18:50327931-50327953 CACCATAATGTAGAATCAGTGGG + Intergenic
1158185870 18:54770504-54770526 CACCATAATGTAGAATCAGTAGG - Intronic
1158289506 18:55923505-55923527 CACCATAATGTAGAATCAGTGGG + Intergenic
1158480895 18:57820940-57820962 CACCATAATGTAGAATCAGTGGG - Intergenic
1158753944 18:60299929-60299951 CACCATAATGTAGAATCAGTGGG + Intergenic
1159524413 18:69568923-69568945 CACCATAATGTAGAATCAGTGGG - Intronic
1159558331 18:69967973-69967995 CACCATAATGTAGAATCAGTGGG + Intergenic
1159573364 18:70145244-70145266 CACCATAATGTAGAATCAGTGGG - Intronic
1160271326 18:77386901-77386923 CACCATAATGTAGAATCAGTGGG - Intergenic
1160369103 18:78356568-78356590 CACCATAATGTAGAATCAGTGGG + Intergenic
1160648233 19:205167-205189 CACCATAATGTAGAATCAGTGGG + Intergenic
1161862303 19:6807247-6807269 CACCATAATGTAGAATCAGTGGG + Intronic
1164450203 19:28355272-28355294 CACCATAATGTAGAATCAGTGGG - Intergenic
1164494597 19:28748348-28748370 CACCATAATGTAGAATCAGTGGG - Intergenic
1164811300 19:31158683-31158705 CACCATAATGTAGAATCAGTGGG + Intergenic
1165410414 19:35657156-35657178 CACCATACTATAGAATCAGTGGG + Intronic
1165683956 19:37802019-37802041 CACCATAATGTAGAATCAGTGGG + Intronic
1166908658 19:46134478-46134500 CACCATACTGTAGAATCAGTGGG + Intergenic
1167223162 19:48216917-48216939 CACCATAATGTAGAATCAGTGGG + Intronic
1168392852 19:56025139-56025161 CACCATAATGTAGGATCAGTGGG - Intronic
925198368 2:1946260-1946282 CACCATAATGTAGAATCAGTGGG - Intronic
926846968 2:17152136-17152158 CACCATAATGTAGAATCAGTGGG + Intergenic
927204422 2:20598205-20598227 CACCATAATGTAGAATCAGTGGG + Intronic
927244202 2:20943715-20943737 CACCATAATGTAGCCTCAGTGGG + Intergenic
927547865 2:23970686-23970708 CACCATAATGTAGAATCAGTGGG + Intronic
929111109 2:38405928-38405950 CACCATAATGTAGAATCAGTGGG + Intergenic
930422758 2:51175021-51175043 CACCATAATGTAGAATCAGTGGG - Intergenic
930424229 2:51193509-51193531 CAGCAAACTGCAGCAGCCCTAGG - Intergenic
932599659 2:73114669-73114691 CACCATAATGTAGAATCAGTGGG - Intronic
932605190 2:73160687-73160709 CACCATAATGTAGAATCAGTGGG + Intergenic
933227816 2:79771475-79771497 CACCATAATGTAGAATCAGTGGG + Intronic
934660657 2:96141964-96141986 CACCATAATGTAGAATCAGTGGG + Intergenic
935096518 2:99949511-99949533 CACCATAATGTAGAATCAGTGGG + Intronic
935111005 2:100094281-100094303 CACCATAATGTAGAATCAGTGGG + Intronic
935565170 2:104598645-104598667 CACCATAATGTAGAATCAGTGGG + Intergenic
935682582 2:105650996-105651018 CACCATAATGTAGAATCAGTGGG + Intergenic
935929291 2:108105997-108106019 CACCCAACTTTAGCATTGGTTGG + Intergenic
936042388 2:109159900-109159922 CACCATAATGTAGAATCAGTTGG - Intronic
936123973 2:109770881-109770903 CACCATAATGTAGAATCAGTGGG - Intergenic
936220716 2:110600583-110600605 CACCATAATGTAGAATCAGTGGG + Intergenic
936511953 2:113155720-113155742 CACCATAATGTAGAATCAGTGGG - Intergenic
938282785 2:130077507-130077529 CACCAAAATGTAGAATCAGTGGG + Intronic
938333419 2:130466078-130466100 CACCAAAATGTAGAATCAGAGGG + Intronic
938356394 2:130654593-130654615 CACCAAAATGTAGAATCAGTGGG - Intronic
938432828 2:131261398-131261420 CACCAAAATGTAGAATCAGTGGG - Intronic
938476833 2:131623647-131623669 CACCAAAATGTAGAATCAGTGGG - Intergenic
938732488 2:134157687-134157709 CACCATAATGTAGAATCAGTGGG + Intronic
939278098 2:140027760-140027782 CACCATAATGTAGAATCAGTGGG - Intergenic
939291513 2:140202021-140202043 CACCATAATGTAGAATCAGTGGG + Intergenic
940293822 2:152101945-152101967 CACCATAATGTAGAATCAGTGGG - Intergenic
940453276 2:153867658-153867680 CACCATAATGTAGAATCAGTGGG + Intergenic
940986785 2:160058949-160058971 CACCATAATGTAGAATCAGTGGG + Intronic
940990706 2:160093243-160093265 CACCATACTGTAGAATCAGTGGG + Intergenic
941411314 2:165160247-165160269 CACCATAATGTAGAATCAGTGGG - Intronic
941509027 2:166382895-166382917 CACCATAATGTAGAATCAGTGGG - Intergenic
941784966 2:169488315-169488337 CACCATAATGTAGAATCAGTGGG + Intronic
942338770 2:174920854-174920876 CACCATAATGTAGAATCAGTAGG + Intronic
942340034 2:174934192-174934214 CACCATAATGTAGAATCAGTGGG + Intronic
942430586 2:175907049-175907071 CACCATAATGTAGAATCAGTGGG + Intergenic
943248157 2:185483072-185483094 CACCATAATGTAGAATCAGTGGG - Intergenic
943906749 2:193508737-193508759 CACCATAATGTAGAATCAGTGGG - Intergenic
944170702 2:196773666-196773688 CACCATAATGTAGAATCAGTGGG + Intronic
945057931 2:205884395-205884417 CACCATAATGTAGAATCAGTGGG - Intergenic
945635197 2:212340436-212340458 CACCATAATGTAGAATCAGTGGG + Intronic
945933457 2:215879922-215879944 CACCATAATGTAGAATCAGTGGG + Intergenic
946078341 2:217094828-217094850 CACCATAATGTAGAATCAGTGGG + Intergenic
946099649 2:217308957-217308979 CACCATAATGTAGAATCAGTGGG + Intronic
946288888 2:218728265-218728287 CACCATAATGTAGAATCAGTGGG + Intronic
946655846 2:221946293-221946315 CACCATAATGTAGAATCAGTGGG + Intergenic
946706263 2:222461549-222461571 CACCATAATGTAGAATCAGTGGG + Intronic
947201772 2:227620602-227620624 CACCATAATGTAGAATCAGTGGG - Intronic
947202503 2:227627168-227627190 CACCATAATGTAGAATCGGTGGG - Intronic
948082142 2:235215104-235215126 CACCATAATGTAGAATCAGTGGG + Intergenic
948085766 2:235245768-235245790 CACCATAATGTAGAATCAGTGGG + Intergenic
948306565 2:236952498-236952520 CACCATAATGTAGAATCAGTGGG - Intergenic
948394901 2:237638154-237638176 CACCATAATGTAGAATCAGTGGG + Intronic
1169550329 20:6695647-6695669 CACCATAATGTAGAATCAGTGGG + Intergenic
1170645471 20:18193397-18193419 CACCATAATGTAGAATCAGTGGG + Intergenic
1170684385 20:18555915-18555937 CACCATAATGTAGAATCAGTGGG + Intronic
1170702864 20:18719436-18719458 CACTAAACTGTCCCATCAGTTGG + Intronic
1170940139 20:20841931-20841953 CACCATAATGTAGAATCAGTGGG - Intergenic
1172280473 20:33704181-33704203 CACCATAATGTAGAATCAGTGGG + Exonic
1172306789 20:33886287-33886309 CACCATAATGTAGAATCAGTGGG - Intergenic
1172678552 20:36693810-36693832 CACCATAATGTAGAATCTGTTGG - Intronic
1172757087 20:37293250-37293272 CACCATAATGTAGAATCAGTGGG + Intronic
1173466688 20:43288521-43288543 CACCATAATGTAGAATCAGTGGG + Intergenic
1173926024 20:46781937-46781959 CACCATAATGTAGAATCAGTGGG + Intergenic
1174194883 20:48766106-48766128 CACCATAATGTAGAATCAGTGGG - Intronic
1174290225 20:49503158-49503180 CACCATAATGTAGAATCAGTGGG + Intergenic
1174714845 20:52746665-52746687 CACCAAAATGTAGAATCAGTGGG - Intergenic
1174795329 20:53517542-53517564 CACCACAATGTAGAATCAGTGGG - Intergenic
1174868925 20:54165399-54165421 CACCATAATGTAGAATCAGTGGG - Intronic
1174958013 20:55122834-55122856 CACCATAATGTAGAATCAGTGGG + Intergenic
1175234349 20:57499625-57499647 CACCATAATGTAGAATCAGTGGG + Intronic
1175522688 20:59612234-59612256 CACCAAACTGCAGCGTCTGCAGG + Intronic
1175577639 20:60074166-60074188 CACCATAATGTAGAATCAGTGGG + Intergenic
1175603997 20:60297607-60297629 CACCATAATGTAGAATCAGTGGG + Intergenic
1177146275 21:17410473-17410495 CACCATAATGTAGAATCAGTGGG - Intergenic
1177805220 21:25868660-25868682 CACCAAAATGTAGAATCAGTGGG + Intergenic
1178458371 21:32777156-32777178 CACCATAATGTAGAATCAGTTGG - Intergenic
1178475037 21:32930654-32930676 CACCATAATGTAGAATCAGTAGG + Intergenic
1178533813 21:33396423-33396445 CACCATAATGTAGAATCAGTGGG - Intergenic
1179097475 21:38328539-38328561 CACCAAAATGTAGAATCAGTGGG + Intergenic
1179598042 21:42456357-42456379 CACCATAATGTAGAATCAGTGGG + Intergenic
1179898084 21:44374505-44374527 CACCATAATGTAGGATCAGTGGG + Intronic
1180476906 22:15719330-15719352 CACCAAAATGTAGAATCAGTGGG - Intronic
1180936176 22:19626607-19626629 CACCATAATGTAGCATCAGTGGG - Intergenic
1182202186 22:28585270-28585292 CACCATAATGTAGAATCAGTGGG + Intronic
1182363543 22:29762667-29762689 CACCATAATGTAGAATCAGTGGG - Intronic
1182525928 22:30919192-30919214 CACCATAATGTAGAATCAGTGGG - Intergenic
1182974484 22:34610237-34610259 CACCATACTGTAAAATCAGTGGG - Intergenic
1183570986 22:38653283-38653305 CACCATAATGTAGAATCAGTGGG - Intronic
1184083503 22:42242991-42243013 CACCAAACTGTAAAGTCAGTAGG + Intronic
949395301 3:3608370-3608392 CACCATAATGTAGAATCAGTGGG - Intergenic
949475510 3:4441351-4441373 CACCATAATGTAGAATCAGTGGG - Intronic
949710896 3:6870135-6870157 CACCAACTTGTAACATCCATAGG - Intronic
950294930 3:11821280-11821302 CACCATAATGTAGAATCAGTGGG + Intronic
951043607 3:18014369-18014391 CACCATAATGTAGAATCAGTGGG - Intronic
951459955 3:22940695-22940717 CACCATAATGTAGAATCAGTGGG - Intergenic
951551420 3:23878792-23878814 CACCATAATGTAGAATCAGTGGG - Intronic
952373547 3:32746388-32746410 CACCATAATGTAGAATCAGTGGG + Intronic
952796232 3:37241879-37241901 CACCATAATGTAGAATCGGTGGG + Intergenic
953707009 3:45238769-45238791 CACCATAATATAGAATCCGTGGG - Intergenic
954174206 3:48830736-48830758 CACCATAATGTAGAATCAGTGGG + Intronic
954308862 3:49748866-49748888 CACCATAATGTAGAATCCTTGGG + Intronic
955698867 3:61663660-61663682 CACCAAACTGTAGAATCAGTGGG + Intronic
956273828 3:67476487-67476509 CACCATAATGTAGAATCAGTGGG - Intronic
956331760 3:68118146-68118168 CACCATAATGTAGAATCAGTGGG + Intronic
956438649 3:69259074-69259096 CACCATAATGTAGAATCAGTGGG + Intronic
956723767 3:72140224-72140246 CACCATAATGTAGAATCAGTGGG + Intergenic
957057470 3:75454997-75455019 CACCATAATGTAGAATCAGTGGG + Intergenic
957632312 3:82732978-82733000 CACCATAATGTAGAATCAGTGGG + Intergenic
959577306 3:107948263-107948285 CACCATAATGTAGAATCAGTGGG - Intergenic
959890872 3:111554824-111554846 CACCATAATGTAGAATCAGTGGG + Intronic
960766414 3:121135431-121135453 CACCATAATGTAGAATCAGTGGG + Intronic
960804912 3:121574395-121574417 CACCATAATGTAGAATCAGTAGG + Intronic
961295983 3:125884733-125884755 CACCATAATGTAGAATCAGTGGG - Intergenic
961889811 3:130121427-130121449 CACCATAATGTAGAATCAGTGGG + Intergenic
962290164 3:134129126-134129148 CACCATAATGTAGAATCAGTGGG + Intronic
963154578 3:142082287-142082309 CACCATAATGTAGAATCAGTGGG - Intronic
963200771 3:142583817-142583839 CACCATAATGTAGAATCAGTGGG + Intergenic
963233787 3:142935879-142935901 CACCATAATGTAGAATCAGTGGG - Intergenic
963624828 3:147658365-147658387 CACCATAATGTAGAATCAGTGGG + Intergenic
964051233 3:152396205-152396227 CACCATAATGTAGAATCAGTGGG - Intronic
964612908 3:158632797-158632819 CACCATAATGTAGAATCAGTGGG + Intergenic
966163409 3:176991200-176991222 CACCATAATGTAGAATCAGTGGG + Intergenic
967486107 3:190032955-190032977 CACCATAATGTAGAATCAGTGGG + Intronic
968369613 3:198214948-198214970 CACCATAATGTAGAATCAGTGGG - Intergenic
969000296 4:3975397-3975419 CACCACAATGTAGAATCAGTGGG + Intergenic
969182074 4:5449897-5449919 CACCATAATGTAGAATCAGTGGG - Intronic
969226588 4:5802552-5802574 CACCATAATGTAGAATCAGTGGG + Intronic
969753725 4:9133261-9133283 CACCATAATGTAGAATCAGTGGG - Intergenic
969813610 4:9669449-9669471 CACCACAATGTAGAATCAGTGGG - Intergenic
970430501 4:15984774-15984796 CACCACAGTGTAGAATCAGTGGG - Intronic
970510091 4:16773374-16773396 CACCATAATGTAGAATCAGTGGG + Intronic
970869058 4:20793719-20793741 CACCATAATGTAGAATCAGTGGG + Intronic
970955567 4:21806972-21806994 CACCATAATGTAGAATCAGTGGG + Intronic
971541152 4:27818242-27818264 CAACAATCTCTGGCATCCGTTGG - Intergenic
971673149 4:29590767-29590789 CACCATAATGTAGAATCTGTGGG + Intergenic
972157872 4:36186863-36186885 CACCATAATGTAGAATCAGTGGG - Intronic
972536910 4:40007497-40007519 CACCATAATGTAGAATCAGTGGG + Intergenic
972600760 4:40570280-40570302 CACCACAATGTAGAATCAGTGGG + Intronic
973134914 4:46695418-46695440 CACTATAATGTAGAATCCGTGGG + Intergenic
974363996 4:60921811-60921833 CACCATAATGTAGAATCAGTGGG + Intergenic
975789434 4:77932695-77932717 CACCATGCTGTAGAATCAGTGGG - Intronic
976165296 4:82248076-82248098 CACCATAATGTAGAATCAGTAGG - Intergenic
976440953 4:85073950-85073972 CACCATAATGTAGAATCAGTGGG + Intergenic
977001625 4:91511790-91511812 CACCATAATGTAGAATCAGTGGG - Intronic
977910117 4:102524631-102524653 CACCATAATGTAGAATCAGTAGG + Intronic
978173765 4:105705371-105705393 CACCATAATGTAGAATCAGTGGG - Intronic
978637258 4:110824327-110824349 CACCATAATGTAGAATCAGTGGG + Intergenic
979095650 4:116546745-116546767 CACCATAATGTAGCATCAGTGGG + Intergenic
979115009 4:116812360-116812382 CACCATAATGTAGAATCAGTGGG - Intergenic
979329637 4:119410229-119410251 CACCATAATGTAGAATCAGTGGG + Intergenic
979444361 4:120793360-120793382 CACCATAATGTAGAATCAGTGGG - Intronic
979685125 4:123503677-123503699 CACCATAATGTAGAATCAGTGGG + Intergenic
980016660 4:127657789-127657811 CACCATAATGTAGAATCAGTGGG - Intronic
980016763 4:127658885-127658907 CACCATAATGTAGAATCAGTGGG + Intronic
981786301 4:148482988-148483010 CACCATAATGTAGAATCAGTGGG - Intergenic
981990376 4:150912485-150912507 CACCATAATGTAGAATCAGTGGG - Intronic
982023932 4:151233203-151233225 CACCATAATGTAGAATCAGTGGG - Intronic
982102205 4:151978896-151978918 CACCATAATGTAGAATCCATGGG + Intergenic
982104287 4:151998109-151998131 CACCATACTGTAGAATCAGTGGG - Intergenic
982678583 4:158403520-158403542 CACCATAATGTAGAATCAGTGGG - Intronic
983679988 4:170342268-170342290 CACCATAATGTAGAATCAGTGGG - Intergenic
984480252 4:180291637-180291659 CACCATAATGTAGAATCAGTGGG - Intergenic
984788030 4:183587237-183587259 CACCATAATGTAGAATCAGTGGG - Intergenic
985080526 4:186260023-186260045 CACCATAATGTAGAATCAGTGGG + Intergenic
985887307 5:2689512-2689534 CACCATAATGTAGAATCCGTGGG - Intergenic
987271016 5:16309228-16309250 CACCATAATGTAGAATCAGTGGG + Intergenic
988589519 5:32536676-32536698 CACCATAATGTAGAATCCGTGGG - Intronic
988689477 5:33558036-33558058 CACCAAAATGTAGAATCAGTGGG - Intronic
988730034 5:33963319-33963341 CTCCAAATGGTAGCATCCTTGGG - Intronic
989705318 5:44322805-44322827 CACCATAATGTAGAATCAGTGGG - Intronic
990009677 5:50981852-50981874 CACCATAATGTAGAATCAGTGGG - Intergenic
990148079 5:52785532-52785554 CACCATAATGTAGAATCAGTGGG + Intergenic
990323578 5:54652585-54652607 CACCATAATGTAGAATCAGTGGG - Intergenic
991430860 5:66543514-66543536 CACCATAATGTAGAATCAGTGGG - Intergenic
991670083 5:69038516-69038538 CACCATAATGTAGAATCAGTGGG + Intergenic
992125221 5:73632949-73632971 CACCATAATGTAGAATCAGTGGG + Intronic
992485657 5:77191841-77191863 CACCATAATGTAGAATCAGTGGG + Intergenic
992585801 5:78238323-78238345 CACCATAATGTAGAATCAGTGGG - Intronic
992664087 5:78989005-78989027 CACCATAATGTAGAATCAGTGGG + Intergenic
993011906 5:82492551-82492573 CACCATAATGTAGAATCAGTGGG - Intergenic
993037273 5:82771542-82771564 CACCAAAATGTAGAATCAGTGGG + Intergenic
993078779 5:83269971-83269993 CACCATAATGTAGAATCAGTGGG + Intronic
993307269 5:86288642-86288664 CACCATAATGTAGAATCAGTGGG - Intergenic
994197994 5:96941036-96941058 CACCATAATGTAGAATCAGTGGG + Intronic
994480030 5:100322834-100322856 CACCATAATGTAGAATCAGTGGG - Intergenic
994671449 5:102766276-102766298 CACCATAATGTAGAATCAGTGGG + Intronic
994943795 5:106359352-106359374 CACCATAATGTAGAATCAGTGGG - Intergenic
995339685 5:111044103-111044125 CACCATAATGTAGAATCAGTGGG + Intergenic
995662416 5:114499998-114500020 CACCATAATGTAGAATCAGTAGG - Intergenic
995709569 5:115021266-115021288 CACCAAAATGTAGAATCAGTGGG + Intergenic
995860555 5:116636064-116636086 CACCATAATGTAGAATCAGTAGG - Intergenic
996004499 5:118404772-118404794 CAGCAAACTGTAGCAGCCCTAGG - Intergenic
996567746 5:124897794-124897816 CACCATAGTGTAGAATCAGTGGG - Intergenic
997825664 5:137104783-137104805 CACCATAGTGTAGCATCAGCGGG - Intronic
998606295 5:143638624-143638646 CACCATAATGTAGAATCAGTGGG + Intergenic
998765525 5:145482718-145482740 CACCATAATGTAGAATCAGTAGG + Intronic
998915806 5:147010413-147010435 CACCATAATGTAGAATCAGTGGG + Intronic
999193749 5:149767953-149767975 CACCATAATGTAGAATCAGTGGG + Intronic
999587265 5:153103725-153103747 CACCACAATGTAGAATCAGTGGG - Intergenic
999858486 5:155620547-155620569 CACCAAACTGCAGCCTCCATGGG - Intergenic
999883601 5:155894801-155894823 CACCATAATGTAGAATCAGTGGG - Intronic
1000308773 5:160020796-160020818 CACCATAATGTAGAATCAGTGGG - Intronic
1000362540 5:160461355-160461377 CACCATAATGTAGAATCAGTGGG + Intergenic
1000609433 5:163358302-163358324 CACCATAATGTAGAATCAGTGGG - Intergenic
1000957324 5:167558698-167558720 CACCATAATGTAGAATCAGTGGG - Intronic
1002728893 5:181320533-181320555 CACCATAATGTAGAATCAGTGGG - Intergenic
1002765063 6:232352-232374 CACCATAATGTAGAATCAGTGGG + Intergenic
1003365585 6:5471830-5471852 CACCACACTGCAGCTTCCCTGGG - Intronic
1004148448 6:13091641-13091663 CACCATAATGTAGAATCAGTGGG + Intronic
1004157909 6:13186885-13186907 CACCATAATGTAGAATCTGTGGG + Intronic
1004327233 6:14686466-14686488 CACCATAATGTAGAATCTGTGGG + Intergenic
1004385619 6:15170298-15170320 CAACAGACTGTAGCCTCCTTGGG + Intergenic
1004599295 6:17132303-17132325 CACCATAATGTAGAATCAGTGGG - Intergenic
1004632708 6:17437076-17437098 CACCACAATGTAGAATCTGTGGG - Intronic
1004672486 6:17810637-17810659 CACCATAATGTAGAATCAGTGGG + Intronic
1004770100 6:18771657-18771679 CACCATAATGTAGAATCAGTGGG - Intergenic
1005051276 6:21686110-21686132 CACCATAATGTAGAATCAGTGGG - Intergenic
1005099652 6:22156825-22156847 CACCAAACTATAAGATCCATGGG + Intergenic
1010120882 6:72374815-72374837 CACCATAATGTAGAATCAGTGGG + Intronic
1011035862 6:82974021-82974043 CACCATAATGTAGAATCAGTGGG - Intronic
1011292770 6:85793636-85793658 CACCATAATGTAGAATCAGTGGG - Intergenic
1011804951 6:91061212-91061234 CACCATAGTGTAGAATCAGTGGG - Intergenic
1011934594 6:92759573-92759595 CACCATAATGTAGAATCAGTGGG - Intergenic
1012433925 6:99194460-99194482 CACCATAATGTAGAATCAGTGGG - Intergenic
1013036065 6:106384440-106384462 CACCATAATGTAGAATCAGTGGG + Intergenic
1013377245 6:109529616-109529638 CACCATAATGTAGAATCAGTGGG + Intronic
1013922998 6:115432593-115432615 CACCATAATGTAGAATCAGTGGG + Intergenic
1013959015 6:115875443-115875465 CACCATAATGTAGAATCAGTGGG + Intergenic
1014010445 6:116469531-116469553 CACCATAATGTAGAATCAGTGGG + Intergenic
1014191084 6:118497443-118497465 CACCATAATGTAGAATCAGTGGG - Intronic
1014650469 6:124030170-124030192 CACCATAATGTAGAATCAGTGGG - Intronic
1014830824 6:126100822-126100844 CACCATAATGTAGAATCAGTGGG + Intergenic
1015240877 6:131022049-131022071 CACCATAATGTAGAATCAGTGGG + Intronic
1015904583 6:138103687-138103709 CACCATAATGTAGAATCAGTGGG + Intronic
1016004294 6:139074108-139074130 CACCATAATGTAGAATCAGTGGG + Intergenic
1016588405 6:145715851-145715873 CACCATAATGTAGAATCAGTGGG - Intronic
1016666940 6:146653230-146653252 CACCATAATGTAGCATCAGCGGG - Intronic
1016841371 6:148528870-148528892 CACCATAATGTAGAATCAGTGGG + Intronic
1016845015 6:148561149-148561171 CACCATAATGTAGAATCAGTGGG - Intergenic
1020109012 7:5437649-5437671 CAGATAACTGTAGCATCCGGCGG + Intronic
1020385118 7:7592555-7592577 CACCATAATGTAGAATCAGTGGG + Intronic
1021284245 7:18759533-18759555 CACCATAATGTAGAATCAGTGGG - Intronic
1021448715 7:20760908-20760930 CACCATAATGTAGGATCAGTGGG - Intronic
1021885237 7:25131273-25131295 CACCATAATGTAGAATCAGTGGG - Intergenic
1022546848 7:31197873-31197895 CACCATAATGTAGAATCAGTGGG + Intergenic
1022573146 7:31472770-31472792 CACCATAATGTAGAATCAGTGGG + Intergenic
1022723606 7:32961899-32961921 CACCATAATGTAGAATCAGTGGG - Intronic
1022881872 7:34596025-34596047 CACCATAATGTAGAATCAGTGGG - Intergenic
1022950983 7:35337682-35337704 CACCATAATGTAGAATCAGTGGG + Intergenic
1023277490 7:38535615-38535637 CACCATAATGTAGAATCAGTGGG + Intronic
1023332942 7:39138648-39138670 CACCATAATGTAGAATCAGTGGG - Intronic
1023400686 7:39791632-39791654 CACCATAATGTAGAATCAGTGGG - Intergenic
1024073618 7:45807378-45807400 CACCATAATGTAGAATCAGTGGG - Intergenic
1024520162 7:50298696-50298718 CACCATAATGTAGAATCAGTGGG + Intergenic
1024649718 7:51392821-51392843 CACCATAATGTAGAATCAGTGGG + Intergenic
1024818345 7:53297015-53297037 CACCACAATGTAGAATCAGTGGG - Intergenic
1025053797 7:55748152-55748174 CACCATAATGTAGAATCAGTGGG + Intergenic
1025131902 7:56378626-56378648 CACCATAATGTAGAATCAGTGGG + Intergenic
1025184678 7:56848473-56848495 CACTAAAATGTAGAATCAGTGGG + Intergenic
1025185869 7:56857978-56858000 CACCATAATGTAGAATCAGTGGG + Intergenic
1025686057 7:63718963-63718985 CACCATAATGTAGAATCAGTGGG - Intergenic
1025687252 7:63728489-63728511 CACTAAAATGTAGAATCAGTGGG - Intergenic
1026555158 7:71401799-71401821 CACCATAATGTAGAATCAGTGGG - Intronic
1027395045 7:77745783-77745805 CACCATAATGTAGAATCAGTGGG + Intronic
1028479804 7:91292343-91292365 CACCATAATGTAGAATCAGTGGG - Intergenic
1028768681 7:94589800-94589822 CACCATAATGTAGAATCAGTGGG - Intronic
1029015681 7:97313353-97313375 CACCATAATGTAGAATCAGTGGG + Intergenic
1029195498 7:98802592-98802614 CACCAAAAGGTAACATCTGTGGG - Intergenic
1030282609 7:107792352-107792374 CACCATAATGTAGAATCAGTGGG + Intronic
1030479271 7:110081999-110082021 CACCATAATGTAGAATCAGTGGG + Intergenic
1031430020 7:121656797-121656819 CACCATAATGTAGAATCAGTGGG + Intergenic
1031759395 7:125692623-125692645 CACCATAATGTAGAATCAGTGGG - Intergenic
1031826776 7:126575360-126575382 CACCATAATGTAGAATCAGTGGG - Intronic
1032051014 7:128651076-128651098 CACCATAATGTAGAATCAGTGGG - Intergenic
1032343232 7:131095127-131095149 CACCATAATGTAGTATCAGTGGG - Intergenic
1032591560 7:133196787-133196809 CACCATAATGTAGAATCAGTGGG + Intergenic
1032621982 7:133543761-133543783 CCTCAAACTGAAGCATCCATGGG + Intronic
1032698882 7:134361470-134361492 CACCACAATGTAGAATCAGTGGG + Intergenic
1032707271 7:134432311-134432333 CACCATAATGTAGAATCAGTGGG + Intergenic
1033064984 7:138145904-138145926 CACCATAATGTAGAATCAGTGGG + Intergenic
1033681507 7:143600353-143600375 CAAGAAACTGTAGCATTCCTTGG - Intergenic
1033684621 7:143627053-143627075 CACCATAATGTAGAATCAGTGGG + Intronic
1033684824 7:143628744-143628766 CACCATAATGTAGAATCAGTGGG - Intronic
1033687797 7:143706272-143706294 CACCATAATGTAGAATCAGTGGG + Intronic
1033687999 7:143707963-143707985 CACCATAATGTAGAATCAGTGGG - Intronic
1033699789 7:143828877-143828899 CACCATAATGTAGAATCAGTGGG + Intergenic
1033699990 7:143830570-143830592 CACCATAATGTAGAATCAGTGGG - Intergenic
1033703385 7:143861460-143861482 CAAGAAACTGTAGCATTCCTTGG + Intronic
1033729933 7:144168072-144168094 CACCATAATGTAGAATCAGTGGG - Intergenic
1034319650 7:150168471-150168493 CACCATAATGTAGAATCAGTGGG - Intergenic
1034685306 7:152966005-152966027 CACCATAATGTAGAATCTGTGGG + Intergenic
1034773106 7:153798748-153798770 CACCATAATGTAGAATCAGTGGG + Intergenic
1034987365 7:155524663-155524685 CACCATAATGTAGAATCAGTGGG - Intronic
1035944230 8:3942183-3942205 CACCATAATGTAGAATCAGTGGG - Intronic
1036038169 8:5042981-5043003 CACCAGAATGTAGAATCAGTGGG + Intergenic
1036115986 8:5961418-5961440 CACCATAATGTAGAATCAGTGGG + Intergenic
1037023103 8:13998444-13998466 CACCATAATGTAGAATCAGTGGG + Intergenic
1037354944 8:18008391-18008413 CACCATAATGTAGAATCAGTGGG - Intronic
1037530082 8:19764565-19764587 CACCATAATGTAGAATCAGTGGG + Intergenic
1037845567 8:22278956-22278978 CACCATAATGTAGAATCAGTGGG - Intronic
1038191056 8:25321458-25321480 CACCATAATGTAGAATCAGTGGG + Intronic
1038202782 8:25430582-25430604 CACCATAATGTAGAATCAGTGGG - Intronic
1038285275 8:26200790-26200812 CACCATAATGTAGAATCAGTGGG - Intergenic
1038345876 8:26732047-26732069 CACCATAATGTAGAATCAGTGGG - Intergenic
1038351607 8:26780941-26780963 CACCATAATGTAGAATCAGTGGG - Intronic
1038681306 8:29670869-29670891 CACCATAATGTAGAATCAGTGGG - Intergenic
1038863603 8:31414606-31414628 CACCATAATGTAGAATCAGTGGG + Intergenic
1040808459 8:51422192-51422214 CACCATAATGTAGAATCAGTGGG - Intronic
1040905280 8:52463489-52463511 CACCATAATGTAGAATCAGTGGG + Intergenic
1040907462 8:52483415-52483437 CACCATAATGTAGAATCAGTGGG + Intergenic
1041028048 8:53707117-53707139 CACCATAATGTAGAATCAGTGGG - Intergenic
1041351217 8:56949787-56949809 CACCATAATGTAGAATCAGTGGG - Intergenic
1041930822 8:63284604-63284626 CACCATAATGTAGAATCGGTGGG - Intergenic
1042398400 8:68317423-68317445 CACCATAATGTAGAATCAGTGGG + Intronic
1043013628 8:74910833-74910855 CACCATAATGTAGAATCAGTGGG - Intergenic
1043250328 8:78064426-78064448 CACCATAATGTAGAATCAGTAGG - Intergenic
1043536461 8:81210312-81210334 CACCATAATGTAGAATCAGTGGG + Intergenic
1043697731 8:83242085-83242107 CACCATAATGTAGAATCAGTGGG + Intergenic
1043781337 8:84339520-84339542 CACCATAATGTAGAATCAGTGGG - Intronic
1043979123 8:86617956-86617978 CACCATAATGTAGAATCAGTGGG + Intronic
1044067180 8:87713129-87713151 CACCATAATGTAGAATCAGTGGG - Intergenic
1044170199 8:89041837-89041859 CACCATAATGTAGAATCAGTGGG - Intergenic
1044416426 8:91945305-91945327 CACCATAATGTAGAATCAGTGGG + Intergenic
1044503412 8:92989628-92989650 CACCATAATGTAGAATCAGTGGG - Intronic
1045641738 8:104259208-104259230 CACCATAATGTAGAATCAGTGGG + Intergenic
1045724970 8:105161385-105161407 CACCATAATGTAGAATCAGTGGG - Intronic
1046022867 8:108687574-108687596 CACCATAATGTAGAATCAGTGGG + Intronic
1046526681 8:115389806-115389828 CACCATAATGTAGAATCAGTGGG + Intergenic
1046998783 8:120552835-120552857 CACCATAATGTAGAATCAGTGGG + Intronic
1047240743 8:123085894-123085916 AACCAAACTGGGGCATCTGTGGG - Intronic
1047301649 8:123618585-123618607 CACCATAATGTAGAATCAGTGGG - Intergenic
1047513957 8:125537415-125537437 CACCAAACTGTAGAATCAGTGGG + Intergenic
1047791196 8:128205537-128205559 CACCATAATGTAGAATCAGTGGG - Intergenic
1048066125 8:130970476-130970498 CACCATAATGTAGAATCAGTGGG - Intronic
1048387678 8:133927766-133927788 CACCATAATGTAGAATCAGTGGG + Intergenic
1048938118 8:139373815-139373837 CACCATAATGTAGAATCAGTGGG - Intergenic
1049000035 8:139819292-139819314 CACCATAATGTAGTATCAGTGGG - Intronic
1051063805 9:13077198-13077220 CACCATAATGTAGAATCAGTGGG + Intergenic
1051332108 9:16033564-16033586 CACCATAATGTAGAATCAGTGGG - Intronic
1051665447 9:19463995-19464017 CACCATAATGTAGAATCAGTGGG + Intergenic
1052589794 9:30477208-30477230 CACCATAATGTAGAATCGGTGGG - Intergenic
1052613811 9:30812220-30812242 CACCATAATGTAGAATCAGTGGG - Intergenic
1052668808 9:31528925-31528947 CACCATAATGTAGAATCAGTAGG + Intergenic
1053728565 9:41028755-41028777 CACCATAATGTAGAATCAGTGGG + Intergenic
1054699938 9:68403325-68403347 CACCATAATGTAGAATCAGTGGG - Intronic
1054872108 9:70056993-70057015 CACCATAATGTAGAATCAGTGGG - Intronic
1054945216 9:70788682-70788704 CACCATAATGTAGAATCAGTGGG + Intronic
1055699811 9:78931394-78931416 CACCATAATGTAGAATCAGTGGG + Intergenic
1055934232 9:81590038-81590060 CCCCAAACTGCACCATCCGCAGG + Intronic
1056674680 9:88665213-88665235 CACCATAATGTAGAATCAGTGGG - Intergenic
1057020673 9:91694939-91694961 CACCATAATGTAGAATCAGTGGG - Intronic
1058190490 9:101908906-101908928 CACCATAATGTAGAATCAGTGGG + Intergenic
1058287161 9:103192425-103192447 CACCATAATGTAGAATCAGTGGG - Intergenic
1058864766 9:109151593-109151615 CACCATAATGTAGAATCAGTGGG - Intronic
1059139622 9:111840725-111840747 AACCAAACTGTAGTATCTGTAGG + Intergenic
1059800616 9:117746146-117746168 CACCATAATGTAGAATCAGTGGG + Intergenic
1060307564 9:122429413-122429435 CAGTAAAATGTAGCATACGTCGG - Intergenic
1060345968 9:122816116-122816138 CACCAAAATGTAGAATCAGTGGG + Intronic
1061844227 9:133377847-133377869 CACCATAATGTAGAATCAGTGGG + Intronic
1062248347 9:135581661-135581683 CACCATAGTGTAGAATCGGTGGG - Intergenic
1062753953 9:138277632-138277654 CACCATAATGTAGAATCAGTGGG - Intergenic
1203576472 Un_KI270745v1:12411-12433 CACCATAATGTAGAATCAGTGGG - Intergenic
1203576869 Un_KI270745v1:15820-15842 CACCATAATGTAGAATCAGTGGG - Intergenic
1185521950 X:747054-747076 CAGCATAATGTAGCATCGGTGGG + Intergenic
1185834895 X:3336252-3336274 CACCATAATGTAGAATCAGTGGG - Intronic
1187014187 X:15309439-15309461 CACCATAATGTAGAATCTGTGGG - Intronic
1187022045 X:15393782-15393804 CACCATAATGTAGAATCAGTAGG - Intronic
1187022059 X:15393885-15393907 CACCATAATGTAGAATCAGTAGG - Intronic
1187693239 X:21893083-21893105 CACCATAATGTAGAATCAGTGGG + Intergenic
1190037643 X:47040539-47040561 CACCATAATGTAGAATCAGTGGG - Intronic
1190616606 X:52240234-52240256 CACCATAATGTAGGATCAGTGGG + Intergenic
1191129162 X:56989843-56989865 CACCATAATGTAGAATCAGTAGG - Intronic
1191212612 X:57904476-57904498 CACCATAATGTAGAATCAGTGGG + Intergenic
1192295392 X:69842337-69842359 CACCATAATGTAGAATCAGTGGG - Intronic
1195349370 X:103982278-103982300 CACCATAATGTAGAATCAGTGGG - Intergenic
1195358073 X:104056561-104056583 CACCATAATGTAGAATCAGTGGG + Intergenic
1195423286 X:104699275-104699297 CACCATAATGTAGAATCAGTGGG + Intronic
1195465817 X:105177364-105177386 CACCATAATGTAGAATCAGTGGG - Intronic
1196488543 X:116242994-116243016 CACCATAGTGTAGAATCAGTGGG + Intergenic
1197709970 X:129658840-129658862 CACCACAATGTAGAATCAGTGGG - Intergenic
1197932390 X:131709495-131709517 CACCATAATGTAGAATCAGTAGG + Intergenic
1198395563 X:136215514-136215536 CACCATAATGTAGAATCAGTGGG - Intronic
1198558646 X:137824537-137824559 CACCATAATGTAGAATCAGTGGG + Intergenic
1199200025 X:145076279-145076301 CACCATAATGTAGAATCAGTGGG + Intergenic
1200825308 Y:7632370-7632392 CACCATAATGTAGAATCAGTGGG + Intergenic
1201241873 Y:11965241-11965263 CACCATAGTGTAGAATCAGTGGG + Intergenic
1201534406 Y:15030297-15030319 CACCATAATGTAGAATCAGTGGG + Intergenic
1201577483 Y:15476787-15476809 CACCATAATGTAGAATCAGTGGG + Intergenic
1201677864 Y:16607888-16607910 CTCCATAATGTAGCATCCATGGG + Intergenic
1201855836 Y:18540495-18540517 CACCATAATGTAGAATCAGTGGG + Intergenic
1201877485 Y:18779890-18779912 CACCATAATGTAGAATCAGTGGG - Intronic
1202202594 Y:22368987-22369009 CACCATAATGTAGAATCCGTGGG - Intronic
1202234749 Y:22698716-22698738 CACCATAATGTAGAATCAGTGGG - Intergenic
1202308410 Y:23497452-23497474 CACCATAATGTAGAATCAGTGGG + Intergenic
1202562391 Y:26173134-26173156 CACCATAATGTAGAATCAGTGGG - Intergenic