ID: 1102943274

View in Genome Browser
Species Human (GRCh38)
Location 12:116962500-116962522
Sequence GAAAACAGTGTGCAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 243}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102943258_1102943274 16 Left 1102943258 12:116962461-116962483 CCCTCGCCTCCCCACTGTGTCCC 0: 1
1: 0
2: 2
3: 49
4: 498
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943262_1102943274 10 Left 1102943262 12:116962467-116962489 CCTCCCCACTGTGTCCCCTGGGG 0: 1
1: 0
2: 8
3: 54
4: 467
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943269_1102943274 5 Left 1102943269 12:116962472-116962494 CCACTGTGTCCCCTGGGGGGGCA 0: 1
1: 0
2: 1
3: 22
4: 226
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943266_1102943274 7 Left 1102943266 12:116962470-116962492 CCCCACTGTGTCCCCTGGGGGGG 0: 1
1: 1
2: 0
3: 30
4: 316
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943271_1102943274 -5 Left 1102943271 12:116962482-116962504 CCCTGGGGGGGCACCACTGAAAA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943272_1102943274 -6 Left 1102943272 12:116962483-116962505 CCTGGGGGGGCACCACTGAAAAC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943256_1102943274 24 Left 1102943256 12:116962453-116962475 CCTCTCCACCCTCGCCTCCCCAC 0: 1
1: 3
2: 21
3: 233
4: 2073
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943259_1102943274 15 Left 1102943259 12:116962462-116962484 CCTCGCCTCCCCACTGTGTCCCC 0: 1
1: 0
2: 6
3: 66
4: 609
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943257_1102943274 19 Left 1102943257 12:116962458-116962480 CCACCCTCGCCTCCCCACTGTGT 0: 1
1: 0
2: 4
3: 55
4: 572
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943270_1102943274 -4 Left 1102943270 12:116962481-116962503 CCCCTGGGGGGGCACCACTGAAA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243
1102943268_1102943274 6 Left 1102943268 12:116962471-116962493 CCCACTGTGTCCCCTGGGGGGGC 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102943274 Original CRISPR GAAAACAGTGTGCAGACTGC TGG Intronic
900561701 1:3310281-3310303 GAAAGGTGTGTGCACACTGCAGG - Intronic
902684499 1:18067135-18067157 GAAACCAGTATGCAAACTGGTGG - Intergenic
902904355 1:19543922-19543944 GAAAACACTTAGCAGGCTGCAGG - Intergenic
903178578 1:21594396-21594418 GAAGAGAGTGTGCATACCGCAGG - Intergenic
906059410 1:42938658-42938680 GAAGTCAGTGTGCCCACTGCAGG + Intronic
907386580 1:54129454-54129476 GAAAACACTCTCCAGGCTGCAGG - Intergenic
909189890 1:72538732-72538754 GATATCAGTGTGGACACTGCAGG + Intergenic
909712382 1:78666639-78666661 GAAAGGAGTGTGCAGACTTGTGG + Intergenic
911556551 1:99352351-99352373 GAGAACAGTGCGCTCACTGCAGG + Intergenic
913577509 1:120191777-120191799 GAAAAGAGTGTGAAAATTGCTGG - Intergenic
913598892 1:120404392-120404414 CAAAAAAGTTTGGAGACTGCTGG + Intergenic
914088484 1:144475228-144475250 CAAAAAAGTTTGGAGACTGCTGG - Intergenic
914310128 1:146458982-146459004 CAAAAAAGTTTGGAGACTGCTGG + Intergenic
914559422 1:148803204-148803226 GAAAAGAGTGTGAAAATTGCTGG - Intergenic
914591982 1:149114157-149114179 CAAAAAAGTTTGGAGACTGCTGG - Intergenic
914613411 1:149327019-149327041 GAAAAGAGTGTGAAAATTGCTGG + Intergenic
915355658 1:155254200-155254222 GAAAACAGGGTGCAGACTCAGGG + Intronic
920688746 1:208129732-208129754 CAATACAGTATGCAGAGTGCTGG - Intronic
922865178 1:228853710-228853732 AACAGCAGTGTGCAGACTCCTGG - Intergenic
923353938 1:233135220-233135242 AATGACAGTGTGCACACTGCTGG + Intronic
924765391 1:247027337-247027359 GAAAACACTTAGCAGGCTGCAGG - Intergenic
1065015246 10:21456832-21456854 GAAGACAGTGTGAAGACACCAGG - Intergenic
1066990443 10:42508249-42508271 GAAAACACTTAGCAGGCTGCAGG + Intergenic
1067102001 10:43340616-43340638 GGAAATACTGTGCAGACTCCGGG + Intergenic
1067165435 10:43863304-43863326 GAAAGCATTGTGCAGACTGAGGG + Intergenic
1069056601 10:63850703-63850725 GAAAACACTTAGCAGTCTGCAGG - Intergenic
1069886473 10:71627068-71627090 CAAAACAGTGTCCACACAGCTGG + Intronic
1072337673 10:94413485-94413507 GAAAACCATGTGCAGTGTGCAGG - Intronic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1072820700 10:98554177-98554199 GGAGACAGTGTGCAGGATGCTGG - Intronic
1072851883 10:98904400-98904422 GAAAACATGGTGCAGAAGGCAGG + Intronic
1073086488 10:100893728-100893750 GAAAACAGTTTTTATACTGCTGG + Intergenic
1073585062 10:104702119-104702141 GGCAGTAGTGTGCAGACTGCTGG + Intronic
1074412418 10:113239793-113239815 GAAACCAGACTGCAGAGTGCAGG + Intergenic
1074892764 10:117749118-117749140 GATAACAGTGAGCAGCCGGCAGG - Intergenic
1074980086 10:118612446-118612468 GAAAACACTTAGCAGGCTGCAGG + Intergenic
1079908865 11:26284389-26284411 GATAAAAGTGTGCAGCATGCAGG - Intergenic
1081005457 11:37731175-37731197 GAAAACAGTGTTCAGATGGTTGG + Intergenic
1082992233 11:59217223-59217245 GAAACCAGTGTGAAAACTGATGG + Intergenic
1083985393 11:66211267-66211289 GAACACAGTCTCCAGACTGTTGG + Intronic
1084856847 11:71994886-71994908 CACTACAGTGTGCAGATTGCAGG - Intronic
1085486028 11:76863362-76863384 GGAAACTCTGAGCAGACTGCAGG + Intronic
1085907446 11:80781282-80781304 CCAAACACTGTGCAGAGTGCTGG - Intergenic
1087247205 11:95853306-95853328 GAAAAAAGTGAGCAAACTTCTGG - Intronic
1089700030 11:120239213-120239235 GAAAGCTGTGTGCAGACAGGAGG - Intronic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1091296900 11:134480317-134480339 GACAACAGTATCCACACTGCAGG + Intergenic
1091790539 12:3269585-3269607 GAACACAGAGGGCAGGCTGCAGG - Intronic
1091896994 12:4113512-4113534 GAAAAAAGTGTGGAAACTGAGGG - Intergenic
1093525427 12:20099562-20099584 GAAAACAGTCAGCAGAGTGAGGG + Intergenic
1097902392 12:64886250-64886272 GAAACCAGTGTGCAGAGCTCTGG - Intergenic
1098357553 12:69626050-69626072 CAAAACAGTGTTTAGGCTGCGGG + Intergenic
1101435483 12:104660548-104660570 GAACACTGTGTGCAAACAGCAGG + Intronic
1101655167 12:106713660-106713682 AAAAACAGAGTGCATAGTGCAGG - Intronic
1102325529 12:111979448-111979470 GAAAACAGAAAGCAGACTGGTGG + Intronic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1103302602 12:119939574-119939596 GAAACCAGTATACAGACAGCAGG + Intergenic
1104053429 12:125211493-125211515 GAAAACAGGCAGCAGACAGCTGG - Intronic
1104202886 12:126609120-126609142 AAAAACAGTGTGAGGCCTGCTGG - Intergenic
1104239774 12:126976880-126976902 GACAACACAGTGCAGACTGAGGG + Intergenic
1105686170 13:22784378-22784400 GAAAACAGTGTGAAGGTTTCTGG + Intergenic
1105981454 13:25520200-25520222 GAAGACAGAGGGCAGACTGGTGG - Intronic
1108071843 13:46636431-46636453 GAAAACATTCTGCAGATTGGTGG - Intronic
1108279145 13:48843552-48843574 GAACAAAGACTGCAGACTGCAGG + Intergenic
1109429143 13:62209364-62209386 GAAAAAAGAGAGCAGACTGCAGG - Intergenic
1111661634 13:91219981-91220003 GAAAACAGTGTTCTGAATCCAGG + Intergenic
1112007704 13:95268305-95268327 CAAAACAGTGCGAAGGCTGCAGG + Intronic
1112471383 13:99692851-99692873 GAAAACATTATGCAGAGTGAAGG - Intronic
1113987427 13:114329474-114329496 AAAAACAGAGTGTAGAGTGCTGG - Intergenic
1114633410 14:24173639-24173661 GAAAACAGTGTGGAGACAAGTGG - Intronic
1114863677 14:26559698-26559720 GAAGACAGAGAGTAGACTGCTGG + Intronic
1115651455 14:35405023-35405045 GATTACAGGGTGCAGGCTGCAGG - Intergenic
1118055367 14:62074248-62074270 GAGAAAAGTGTGGAGACTGAAGG + Intronic
1120580362 14:86240273-86240295 GAAATCTTTGTACAGACTGCAGG + Intergenic
1124351792 15:28961202-28961224 AGAAACAGTGTGCTGACTGACGG + Intronic
1126103168 15:45131592-45131614 GAACACACTCTGCAGAGTGCTGG + Exonic
1126658218 15:51004192-51004214 GAAATGAGTGTGCTGACTTCAGG + Exonic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1128254789 15:66188664-66188686 GAACCCAGTATGCAGACTCCTGG + Intronic
1129104631 15:73297764-73297786 GAAAGCTGTGTGCAGACCTCTGG + Intronic
1133044391 16:3078995-3079017 GAAAACACTTAGCAGGCTGCAGG + Intronic
1133574640 16:7076877-7076899 GAGACCAGTGAACAGACTGCTGG + Intronic
1133994503 16:10738223-10738245 GAAAACCGTGCTCAGACTTCTGG + Intergenic
1135597379 16:23754850-23754872 GAAAACAATGTGCAGGGTGGCGG - Exonic
1137274826 16:46926574-46926596 GAAAATTGTGTGCAGACCCCAGG + Intronic
1141804822 16:86335698-86335720 GGAAACAGGCTGGAGACTGCGGG - Intergenic
1143312370 17:6002698-6002720 GAAAACACTGTCCAGACTTAAGG + Intronic
1143389399 17:6551380-6551402 GACACCAGTGTCCAGACTCCAGG - Intronic
1146405909 17:32537459-32537481 GAAAAAAGTTTGCTGACTCCAGG + Intronic
1146760788 17:35476150-35476172 GAAAACAGAGGTCAGACTTCAGG + Intronic
1148193125 17:45693720-45693742 GAAAACACTGTGCTGAGTGAAGG - Intergenic
1148355450 17:46972538-46972560 GGTCACATTGTGCAGACTGCTGG - Intronic
1148841232 17:50498606-50498628 GAACACAGTATGCACACTCCGGG - Intergenic
1149406597 17:56358133-56358155 CAAAGCAGAGTGCAGACTCCAGG + Intronic
1152699823 17:81813287-81813309 GAAAGCAGTCTGCAGACACCTGG - Intronic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1157488423 18:48106081-48106103 GCAGGCAGAGTGCAGACTGCAGG + Intronic
1157572401 18:48721641-48721663 GACACCATTGTGCAGACTACAGG + Intronic
1157910643 18:51614892-51614914 GCCAACAGTGTGCAGGCTACAGG - Intergenic
1158801207 18:60911644-60911666 AAAAGCACTGTGCTGACTGCTGG - Intergenic
1158810155 18:61022788-61022810 GAAATCAGTGTGGGGAGTGCAGG + Intergenic
1160323458 18:77917955-77917977 AAGAACAGTGCCCAGACTGCTGG - Intergenic
1162613319 19:11773401-11773423 GAAAATAATGTGTAGCCTGCTGG + Intronic
1164261832 19:23574707-23574729 GAAAACACTTAGCAGGCTGCAGG + Intronic
1166808413 19:45500480-45500502 GAAAACTGTGTTCAGGCTGGGGG - Exonic
1168236181 19:55064540-55064562 GAAAACAGAGTGGTGGCTGCAGG + Intronic
925695389 2:6572035-6572057 GACAACAGGGTGCAGACCTCAGG - Intergenic
927118277 2:19926302-19926324 GAAAACACTTAGCAGGCTGCAGG - Intronic
927317318 2:21699137-21699159 GAAAACAGAGTCCAAGCTGCAGG - Intergenic
928702784 2:33916217-33916239 GAAAACACTTAGCAGGCTGCAGG + Intergenic
930183500 2:48387686-48387708 GAAAACACTTAGCAGGCTGCAGG - Intergenic
934149628 2:89133818-89133840 TAAAACTGTGGGCAGACTCCAGG - Intergenic
934217667 2:90048209-90048231 TAAAACTGTGGGCAGACTCCAGG + Intergenic
935025666 2:99274627-99274649 GAAAACACTTAGCAGGCTGCAGG + Intronic
935221905 2:101022401-101022423 GAAACAGGTGTGCAAACTGCCGG + Exonic
935307900 2:101755605-101755627 GAAAAGAGTGTGCAGCTAGCAGG - Intronic
937334877 2:121056051-121056073 GAAAACATGGTGCTGACTGAAGG + Intergenic
938144580 2:128822787-128822809 ACAAACAGTGTGCAGACAGGAGG + Intergenic
938159654 2:128973769-128973791 GAAAGAAGTGTGCTGAGTGCAGG - Intergenic
939624097 2:144455349-144455371 CAAAACAGTGTGCAGGTTGGTGG - Intronic
940301343 2:152178976-152178998 GAAAACACTTAGCAGGCTGCAGG + Intergenic
941720013 2:168802586-168802608 GATTACAGTGTCCAGAATGCTGG + Exonic
945892974 2:215449957-215449979 GGAAAAAGTTTGCTGACTGCTGG + Intergenic
946206762 2:218114797-218114819 GAAAACAGTTAGCAGGCTGCAGG - Intergenic
948025129 2:234770637-234770659 GAAAGCAGAGTGCAGGCTGTGGG - Intergenic
948030913 2:234816685-234816707 AAAAACAGTCCGGAGACTGCAGG - Intergenic
948819050 2:240529287-240529309 GAAAACGGAGTGGGGACTGCAGG - Exonic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1168853963 20:995824-995846 CAAAATAGTGTGGAGGCTGCTGG - Intronic
1169055784 20:2619638-2619660 GAAAACAGTGTTCACACAGAAGG + Intronic
1170780289 20:19419641-19419663 GAAAAGGGTGTGCAGCCTCCTGG + Intronic
1170794532 20:19534831-19534853 GAAAACAGTTTGGAAAATGCTGG - Intronic
1171086992 20:22246890-22246912 GAAAACACTGTGTTGCCTGCTGG - Intergenic
1172152026 20:32797355-32797377 GACAGCTGTCTGCAGACTGCAGG - Intronic
1172969757 20:38864894-38864916 GAAATCGATTTGCAGACTGCCGG + Intronic
1174998360 20:55598480-55598502 CAATCCAGTGTGCAGAGTGCTGG - Intergenic
1175156183 20:56973134-56973156 GAAGACAGTGCTGAGACTGCAGG - Intergenic
1175401962 20:58706149-58706171 GGAAACAGTGTGGACACTGCAGG + Intronic
1175682142 20:60996682-60996704 GAAAAGAGGGTGCAGATGGCAGG - Intergenic
1177167294 21:17616717-17616739 GAAAAGTGTGTGCAGCCTTCTGG + Intergenic
1178153644 21:29826084-29826106 GAAAAGTGTGTGCAGAGGGCAGG - Intronic
1178278981 21:31264794-31264816 GCAATCAGAGTGCTGACTGCAGG + Intronic
1178430693 21:32516452-32516474 GAAAAAAGTTTGCTGACTCCTGG + Intergenic
1178803491 21:35818766-35818788 GAAATTAGTGTGCAGACTCGGGG + Intronic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
949796506 3:7857035-7857057 AAATACAGTGTGAAAACTGCAGG + Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
954402092 3:50324267-50324289 GACCACAGTGGGCAGGCTGCAGG + Intronic
955142334 3:56281529-56281551 AAGAACAGTGTGCAAGCTGCTGG + Intronic
955677162 3:61460824-61460846 GAAAACATTGTGCAGAAGGAAGG - Intergenic
959276649 3:104285154-104285176 GAAAACATTTAGCAGGCTGCAGG + Intergenic
959340042 3:105117656-105117678 GAAAACAGTGTCCATAATGAGGG - Intergenic
960035382 3:113097227-113097249 GAAAATAGAGTGCAGAATTCAGG - Intergenic
960968968 3:123125558-123125580 GAACACAGTGTGCAAACCCCAGG + Intronic
963269792 3:143274592-143274614 GAAAAAAGTGTACAAACTGTTGG + Intronic
964337605 3:155672963-155672985 GACAACAGTTTGGAGACTGATGG - Intronic
965443738 3:168748795-168748817 AAAAACATTGTGCACAATGCTGG + Intergenic
968815588 4:2820045-2820067 GACAACAGTGTGCTGTGTGCTGG + Intronic
968943764 4:3653050-3653072 TAGAACAGTTTGCAGAGTGCTGG + Intergenic
970010896 4:11457947-11457969 GAAAACTGTGTGAAGACAGAGGG - Intergenic
974273652 4:59686970-59686992 GAAAACAGTGTGAAAACTTCTGG + Intergenic
975026669 4:69557491-69557513 TAAAACATTGTGTAGACTGATGG - Intergenic
975587078 4:75960540-75960562 GAAAATAGTGGACAGATTGCTGG - Intronic
977173040 4:93786208-93786230 GAGAACAGTGTTCAGAATGGTGG + Intergenic
979336366 4:119467929-119467951 TAAAACAGTGTGGGGACTGAAGG - Intergenic
979415179 4:120428900-120428922 GAAAAAAGTGTGGAGAGAGCAGG + Intergenic
979982588 4:127275130-127275152 GAAAACACTTAGCAGGCTGCAGG + Intergenic
980057217 4:128089745-128089767 GAAAACAGTGTTCAGCCTTATGG - Intronic
981824089 4:148919461-148919483 GAAAATAGTCTGCAGACAGAAGG - Intergenic
983239274 4:165213270-165213292 TAAAACAGTGTGGGGACTGAAGG - Intronic
984858470 4:184216203-184216225 GGAAGCAGTTTGCAGGCTGCCGG - Intronic
986026488 5:3855918-3855940 GAAAACAGTGTGCACTTTGCGGG - Intergenic
986131764 5:4938693-4938715 GAGAACATTGTGCACTCTGCTGG + Intergenic
990281915 5:54260186-54260208 GAAAGAAGAGTGCAGAGTGCAGG - Intronic
990739545 5:58898167-58898189 GAAAACAGTGTCCCAACTGTTGG - Intergenic
992110407 5:73487391-73487413 GATCAAAGTGTGCTGACTGCAGG - Intergenic
995727841 5:115201449-115201471 GAAAAGAGCATGAAGACTGCAGG - Intergenic
996156092 5:120103331-120103353 GAAAACAATGTGTATTCTGCAGG + Intergenic
998758280 5:145404562-145404584 TAATACAGTGTGGAGAGTGCAGG + Intergenic
998940783 5:147280274-147280296 AAATCCAGTGTGCAGACTCCGGG + Intronic
1001012662 5:168112587-168112609 GAATACAGTGTGCAGTGGGCGGG + Intronic
1001824889 5:174736438-174736460 GAAAACGGAGTGCAGAATGCTGG - Intergenic
1001930027 5:175666229-175666251 GAACACAGTCTGGGGACTGCAGG - Intronic
1002843006 6:922247-922269 GAAATCAGTGTGCCAACAGCAGG + Intergenic
1003104070 6:3200568-3200590 GAAACCAGTATGCAGATTTCTGG + Intergenic
1005565083 6:27083581-27083603 GACCACAGTGAGGAGACTGCTGG - Intergenic
1006561542 6:34917216-34917238 GAAAACTGTCAGCAGGCTGCTGG - Intronic
1006936171 6:37720194-37720216 GGAAACACTGTGCAGACTTGTGG + Intergenic
1010133379 6:72522248-72522270 AGCAGCAGTGTGCAGACTGCAGG - Intergenic
1012255246 6:97023681-97023703 GAAAACAGTGAAAAGCCTGCTGG - Intronic
1012460437 6:99454790-99454812 GAAAACAGTATGGAGATGGCTGG + Intronic
1012987376 6:105889041-105889063 GAAAACATGGCTCAGACTGCTGG + Intergenic
1015314705 6:131805626-131805648 AAACACAGTGTGCAGTCTCCAGG - Intergenic
1017613965 6:156224382-156224404 GAAAAGAATGTGCATTCTGCAGG - Intergenic
1019148603 6:169989288-169989310 GGAGACAGAGTGCAGCCTGCTGG - Intergenic
1019743041 7:2684612-2684634 GAAAGGGGTGTGCAGTCTGCCGG + Intronic
1022141375 7:27495930-27495952 GAAAACAGGCTGCAGGCTGGTGG + Intergenic
1023449852 7:40271861-40271883 GAAGATAGAGAGCAGACTGCTGG - Intronic
1023547518 7:41334220-41334242 GAAAACAGAATGAAGACAGCTGG - Intergenic
1023804468 7:43862441-43862463 GAAAACACTTAGCAGACTGTAGG + Intergenic
1024228410 7:47345971-47345993 GAGCACAGTGTGCAGTCAGCTGG - Intronic
1024551103 7:50562869-50562891 TAAAAAAATGTCCAGACTGCCGG + Intronic
1024820351 7:53322204-53322226 GAAAACAGTATGCATAATGACGG - Intergenic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1027492131 7:78841454-78841476 AGAAACAGTGTGCAGACTGAGGG - Intronic
1027528276 7:79298843-79298865 GAAAACTGTGTGAAGACAGAGGG + Intronic
1027945576 7:84741180-84741202 GAAAACAGTGTGGAAAAGGCAGG + Intergenic
1028341458 7:89725633-89725655 GGAGAGAGTGTGCAGACTGTGGG + Intergenic
1032398834 7:131609816-131609838 GAAATGAGTGTGAAGAATGCTGG - Intergenic
1035887645 8:3309074-3309096 GAATCCAGGGTGCAGACTGGAGG - Intronic
1038471692 8:27828984-27829006 GAAGGCAGTTTCCAGACTGCAGG + Intronic
1040609184 8:48965554-48965576 GAAAACACTTAGCAGGCTGCAGG - Intergenic
1040615143 8:49027995-49028017 GAAAACAGAGTTCAGAGAGCAGG - Intergenic
1043024254 8:75046368-75046390 GAAAACACTTAGCAGGCTGCAGG - Intergenic
1043821194 8:84867141-84867163 GAAAACAGTGTGAAGACATGGGG - Intronic
1048267410 8:132999607-132999629 AAAAACAGGCTGCAGGCTGCAGG - Intronic
1048300791 8:133249564-133249586 GTTAACAGTGTGGAGTCTGCGGG + Intronic
1048543588 8:135365320-135365342 GAACACAGTGAGGAGACTACTGG + Intergenic
1050656290 9:7832211-7832233 GTACACAGTTGGCAGACTGCTGG - Intronic
1051337100 9:16075925-16075947 TAAAACAGTGTGCTTACTGGTGG - Intergenic
1059566422 9:115386777-115386799 GAAAACAGTTTGTTGACTTCTGG - Intronic
1060738952 9:126085136-126085158 GACAGCAGTGTGCAGACTAATGG - Intergenic
1061406215 9:130394300-130394322 GAAAACACTGTGCTGAGTCCAGG - Intronic
1062295853 9:135826143-135826165 GACAACAGGGTGCAGACAGCAGG + Intronic
1062365807 9:136208412-136208434 GAAAAGAGGGTGCAGAGTCCAGG - Exonic
1203687510 Un_GL000214v1:9097-9119 GAAAACACTTCGCAGGCTGCAGG - Intergenic
1203648765 Un_KI270751v1:94956-94978 GAAAACACTTCGCAGGCTGCAGG + Intergenic
1190338054 X:49274843-49274865 GAAATCAGCGTGCAGACTTGGGG - Intronic
1190366086 X:49695924-49695946 GAAAAAAGTGTCCGGACAGCAGG + Exonic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194535808 X:95104852-95104874 GAAAACACTTAGCAGGCTGCAGG + Intergenic
1194829187 X:98599426-98599448 GAAAATAGAGGGCAGATTGCTGG + Intergenic
1195392473 X:104376859-104376881 GACAAGAGTGCTCAGACTGCAGG - Intergenic
1195749441 X:108149605-108149627 GAAACCAGTGAGCTGACTTCTGG - Intronic
1195856876 X:109341426-109341448 GAATACAATTTGAAGACTGCTGG + Intergenic
1196023457 X:111014498-111014520 GAACACAGTGTGAAGACCACTGG + Intronic
1196280195 X:113815092-113815114 GAAAACACTGTACAAACTGTTGG + Intergenic
1196555253 X:117077932-117077954 TAAATCAGTGTGCACACTGTAGG - Intergenic
1196783252 X:119400873-119400895 GAGAACTGTTTACAGACTGCAGG - Intronic
1197050485 X:122052040-122052062 GAAAATTGTGTGCAGAATGTTGG + Intergenic
1198586491 X:138128113-138128135 GAAGACTGTGTACAGAGTGCTGG - Intergenic
1198929505 X:141838526-141838548 CAAGACAGTGTGCAGTCTGTTGG + Intronic
1200686797 Y:6265523-6265545 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1200978812 Y:9242214-9242236 GAAAACACTTAGCAGGCTGCGGG - Intergenic
1200989675 Y:9336439-9336461 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1200992344 Y:9356772-9356794 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1200994995 Y:9377050-9377072 GAAAACCGTGTTCAGGCTGGAGG - Intronic
1200997660 Y:9397396-9397418 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1201000172 Y:9465932-9465954 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1201002831 Y:9486242-9486264 GAAAACCGTGTTCAGGCTGGAGG - Intronic
1201005487 Y:9506525-9506547 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1201008150 Y:9526855-9526877 GAAAACCGTGTTCAGGCTGGAGG - Intergenic
1201168740 Y:11236271-11236293 GAAAACACTTAGCAGGCTGCAGG + Intergenic