ID: 1102947788

View in Genome Browser
Species Human (GRCh38)
Location 12:117005172-117005194
Sequence CCAGCAGCAAGATCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102947783_1102947788 21 Left 1102947783 12:117005128-117005150 CCATCTTCTGTTTTGGGTAGGAT 0: 1
1: 0
2: 2
3: 9
4: 170
Right 1102947788 12:117005172-117005194 CCAGCAGCAAGATCCAGGAGTGG 0: 1
1: 0
2: 3
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102947788 Original CRISPR CCAGCAGCAAGATCCAGGAG TGG Intronic
901633777 1:10660250-10660272 CCAGCACCAAGACCGAGGAGCGG - Exonic
901705234 1:11068332-11068354 CCAGCACCAACACCCACGAGGGG + Intronic
902759833 1:18573966-18573988 CCAGCACCAAAATCCCAGAGAGG + Intergenic
903405462 1:23091781-23091803 CCACTAGCAATATCCAGGTGGGG - Exonic
903963411 1:27071349-27071371 CCACCAGCAAGAGGGAGGAGAGG + Intergenic
904058467 1:27687586-27687608 CCATCCGTAAGACCCAGGAGGGG + Intergenic
904198995 1:28807142-28807164 CCATCAGCAAGCTCCAGGAGGGG - Intergenic
904365555 1:30008948-30008970 CCAGCAGCAAAATATAGGATTGG - Intergenic
904768704 1:32869590-32869612 CCAGCCCCAAGATGCAGGTGGGG + Intronic
904893220 1:33794839-33794861 CCCGTAGCAAGATCTAGGTGAGG + Intronic
905119459 1:35670632-35670654 CCAGGGGCAAGAGCAAGGAGAGG - Intergenic
905232533 1:36523214-36523236 CAAGCAGCAAGCCCCAGGAGGGG + Intergenic
905429292 1:37909906-37909928 CTAGAAGCAAGATCCTGGGGAGG - Intronic
910828903 1:91440040-91440062 CCAGCAGCAAGAGACAAGGGGGG + Intergenic
912393388 1:109320492-109320514 CCAACAGCATGATCAAGGAAGGG - Intronic
913145945 1:115990086-115990108 TGAGCAGCAAGAAACAGGAGAGG + Intronic
915735472 1:158081937-158081959 CCAGGAGGAAGATCCTGGATGGG - Intronic
915749189 1:158188831-158188853 CCAGCAGCACTATCAGGGAGGGG + Intergenic
918952112 1:191152079-191152101 CCATCAGCAGGATGCAGGTGGGG + Intergenic
920596755 1:207279720-207279742 CCAGGAGCTAGATCCTGGAATGG + Intergenic
920960213 1:210656881-210656903 CCAGCAGCCAGCCCCTGGAGGGG - Intronic
921696719 1:218219657-218219679 CCTACAGCAATATCCAGGAGTGG - Intergenic
922996925 1:229971518-229971540 CTGGCAGAAAGACCCAGGAGAGG - Intergenic
924566937 1:245206650-245206672 GCAGCATCAAGATCCAGGGTTGG - Intronic
924653133 1:245948703-245948725 GCAGCAGCAGGAGCCAGCAGTGG - Intronic
1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG + Intronic
1065236609 10:23658795-23658817 TCTGAAGCAAGCTCCAGGAGAGG - Intergenic
1065293729 10:24255586-24255608 ACAGGAGCAAGGTACAGGAGTGG + Intronic
1067394005 10:45894866-45894888 CCAGAAGGAAGAACCAGGAATGG + Intergenic
1067680519 10:48434574-48434596 CCTGCAGCAAGATCCATGAATGG - Intronic
1067862327 10:49863999-49864021 CCAGAAGGAAGAACCAGGAATGG + Intronic
1068178047 10:53487234-53487256 CCTGCAGCAGCATCCAGGTGGGG + Intergenic
1069610506 10:69769477-69769499 CCAGAAGGAAGGTCCAAGAGAGG + Intergenic
1069924386 10:71838173-71838195 GAAGCAGCAAGAGCCAAGAGAGG + Intronic
1070711370 10:78685476-78685498 CCAGCAGCCACTTCCAGGATGGG + Intergenic
1072294141 10:93993720-93993742 CCAGCAGCCAGCTCCGGGGGAGG + Intergenic
1073260825 10:102188887-102188909 CAAGCAGCAAGAGCAGGGAGAGG + Intergenic
1073726507 10:106237239-106237261 CCAGCAGCAATAACCATGACAGG + Intergenic
1074770645 10:116731317-116731339 CCAGCTGCCAGGTCTAGGAGGGG + Intronic
1075558341 10:123449388-123449410 CAGGCAGAAACATCCAGGAGTGG + Intergenic
1075588653 10:123675917-123675939 TCAGCTGCAGGAACCAGGAGGGG + Intronic
1075872816 10:125782990-125783012 CCAGCAGAGAGACCCAGGCGTGG - Intergenic
1076432022 10:130410706-130410728 CCACCAGGAAGGTCCAGGATAGG + Intergenic
1076480860 10:130784499-130784521 CCAGCAGCAGGAGCCAGGGAAGG + Intergenic
1076982130 11:210197-210219 CAGGCAGCAAGAGCCAGAAGGGG - Intronic
1077142706 11:1031434-1031456 CCAGCAACATGAGCCAGGACTGG - Intronic
1077333740 11:1994406-1994428 CCAGCAGCAAGACCCCGGGGAGG + Intergenic
1080650412 11:34218318-34218340 CCAAAAGCATGATCCAGGAAAGG - Intronic
1080748056 11:35126766-35126788 GCAGCAGCAAGACCAAGGTGGGG + Intergenic
1081320829 11:41689743-41689765 TCTGCAGCACGATCCAGAAGAGG + Intergenic
1082998235 11:59269343-59269365 CCAGCAGCCAGGTCCAGCTGTGG - Intergenic
1083144274 11:60747026-60747048 CCAGCAGGCTGGTCCAGGAGTGG + Intergenic
1083255431 11:61492538-61492560 ACAGCAGCAGGAGCCAGGGGTGG - Intergenic
1083297759 11:61724459-61724481 CCAGCAGCAAGACCCACGGCAGG - Intronic
1083365559 11:62139720-62139742 CCAGCTGCATGGCCCAGGAGGGG + Intronic
1083473947 11:62903648-62903670 CCAGCTCCAAGGTCCTGGAGAGG - Intergenic
1084218878 11:67665935-67665957 GCAGCAACTGGATCCAGGAGTGG - Intronic
1085732499 11:79011592-79011614 CCAGCAGCCAGTTCCTGGAGAGG - Intronic
1086155631 11:83662655-83662677 CCAGTAGCAAGAGCCAGAACAGG - Intronic
1086286124 11:85253545-85253567 CCAGCAGCAGTATCTAGGGGAGG + Intronic
1087933752 11:104007029-104007051 CCCATAGCAACATCCAGGAGTGG - Intronic
1088386796 11:109267520-109267542 CCAGCAGCACCCTCAAGGAGTGG + Intergenic
1088593048 11:111419669-111419691 CCACCAGCAAGTACCAGCAGCGG + Intronic
1089158949 11:116423284-116423306 CCAGCTGCAGGATGCAGGCGGGG + Intergenic
1089806838 11:121098059-121098081 CCAGCAGGAATATACTGGAGAGG - Intergenic
1090105775 11:123852492-123852514 GCAGAAGCAAGATGGAGGAGGGG - Intergenic
1091107569 11:132937150-132937172 CCGGCAGCAAGATGCAGTGGAGG - Intronic
1091161709 11:133428301-133428323 CCAGCAGCGTGAACAAGGAGAGG + Intronic
1202816720 11_KI270721v1_random:49588-49610 CCAGCAGCAAGACCCCGGGGAGG + Intergenic
1091767310 12:3130086-3130108 CCAACAGCACTATCCTGGAGAGG - Intronic
1093709353 12:22312181-22312203 CCAGGAGAAAGAGCCAGGAGGGG - Intronic
1096553963 12:52391820-52391842 CCAGCAGCAGGCTCCAGGCTGGG - Intergenic
1097004040 12:55902171-55902193 GCAGCAGCAAGAGAAAGGAGAGG - Exonic
1099316858 12:81094918-81094940 GCAGCAGCACGATGCAGGGGAGG - Intronic
1099478793 12:83140895-83140917 CCAGCAGCTACAACCAGGTGTGG + Intergenic
1101745527 12:107538642-107538664 CAAGCAGGAAGAGCCTGGAGGGG - Intronic
1101773814 12:107775706-107775728 CCAGCAGCGAGCCCGAGGAGGGG + Exonic
1102027651 12:109722688-109722710 CCAGCAGGAAGGTCTAGGAGGGG - Intronic
1102653466 12:114460559-114460581 TCAGCAGGGAGACCCAGGAGAGG - Intergenic
1102947788 12:117005172-117005194 CCAGCAGCAAGATCCAGGAGTGG + Intronic
1104708652 12:130968878-130968900 CCTGCAGCAGGCACCAGGAGGGG - Intronic
1106635775 13:31527074-31527096 ACAATATCAAGATCCAGGAGTGG + Intergenic
1106967838 13:35093547-35093569 CCAGCACCAAGATAAAGGACTGG + Intronic
1108095666 13:46898081-46898103 CCAGCTGCAGGCTGCAGGAGAGG - Intergenic
1108498726 13:51049487-51049509 CCAGCAGCACAGTACAGGAGTGG - Intergenic
1109406584 13:61908234-61908256 CTAGCAGCAGGACCCATGAGTGG + Intergenic
1111311612 13:86495057-86495079 CAAGCAGCCAGATGCAGAAGTGG + Intergenic
1111386716 13:87537732-87537754 GCATCTGTAAGATCCAGGAGGGG - Intergenic
1112168081 13:96941301-96941323 TGAGCAGCAAGAAACAGGAGTGG - Intergenic
1112388812 13:98964182-98964204 ACAGCAGCAGGGACCAGGAGTGG + Intronic
1113830111 13:113289019-113289041 TCAGCAGCTGGAGCCAGGAGAGG + Intergenic
1118051905 14:62038341-62038363 GCAGCAGCAAAATCCATCAGGGG + Intronic
1118440837 14:65810093-65810115 TCAGCAGCAGGATCCAGCAAGGG - Intergenic
1119448399 14:74686258-74686280 TCAGCAGAAAGACCAAGGAGAGG + Intronic
1120789125 14:88563153-88563175 TCAGCCGCAAGATCCGGGTGAGG + Exonic
1121729180 14:96174402-96174424 CGAGAAGGAAGATCCAGCAGAGG + Intergenic
1122264829 14:100541686-100541708 CCACCAGCCACAGCCAGGAGTGG + Intronic
1123024495 14:105418405-105418427 CCAGCGGCCAGGTGCAGGAGAGG - Intronic
1123469870 15:20541700-20541722 ACATCAGCATGATCCAGGTGAGG + Exonic
1123648185 15:22458981-22459003 ACATCAGCATGATCCAGGTGAGG - Intronic
1123685729 15:22795759-22795781 CCAGGGGCAAGATACAGAAGAGG + Intronic
1123730164 15:23136722-23136744 ACATCAGCATGATCCAGGTGAGG + Exonic
1123748302 15:23334132-23334154 ACATCAGCATGATCCAGGTGAGG + Intergenic
1124280681 15:28358020-28358042 ACATCAGCATGATCCAGGTGAGG + Intergenic
1124302024 15:28553610-28553632 ACATCAGCATGATCCAGGTGAGG - Intergenic
1125532189 15:40420940-40420962 CCAGGACCAAGAGCCAGGATAGG - Intronic
1126374964 15:47988514-47988536 TCAGCAGCAGCATCCAGGACTGG + Intergenic
1129182781 15:73887501-73887523 TCAGCAGCAAGGCCCAGGAATGG + Intronic
1130513466 15:84607797-84607819 CCAGGAGCAAGGGCCAGGCGTGG - Intronic
1131031653 15:89191217-89191239 CCACCAGGAAAATTCAGGAGAGG - Intronic
1132632792 16:927986-928008 ACAGCAGCAAAACCCAGGAGGGG + Intronic
1134018612 16:10906610-10906632 GCAGCAGCAAGAGCCTGGAGCGG + Exonic
1134642653 16:15841755-15841777 CCAGCAGCAAGAGGTAGAAGGGG - Intronic
1136027902 16:27481759-27481781 ACAGCAGCCAGATGCAGCAGGGG - Intronic
1137376244 16:47954404-47954426 CCAGCATCAGGATCAAGGTGCGG + Intergenic
1137861173 16:51848558-51848580 GCAGCAGCAGGATTCAGGAAAGG - Intergenic
1138830285 16:60366972-60366994 CCTGGAGCAAGATCCAGAAAGGG + Intergenic
1139958029 16:70702484-70702506 CCAGGAGGAAGAGCCTGGAGAGG + Intronic
1140123980 16:72105354-72105376 TCAGCAGGAATGTCCAGGAGTGG + Intronic
1141436344 16:84001894-84001916 CTGGCACCAAGATCCTGGAGAGG - Exonic
1141616341 16:85211778-85211800 CCAGCTGCAAGAGGCAGCAGCGG - Intergenic
1142226889 16:88881877-88881899 CCTGCAGCACGTCCCAGGAGGGG - Intronic
1144254932 17:13458414-13458436 CCAGGAGAGAGGTCCAGGAGTGG - Intergenic
1144435401 17:15235351-15235373 CCAGCATCAAGCTCCATGTGGGG - Intronic
1144968303 17:19091426-19091448 CCAGGAGCAGGAGCAAGGAGGGG + Intergenic
1144979614 17:19160637-19160659 CCAGGAGCAGGAGCAAGGAGGGG - Intergenic
1144988608 17:19217595-19217617 CCAGGAGCAGGAGCAAGGAGGGG + Intronic
1146106196 17:30039540-30039562 CCACAAGCAAGATGCAGGGGTGG - Intronic
1147261586 17:39212236-39212258 CCAGAAGCAAGGTCCAGGCATGG + Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148756561 17:49976142-49976164 CCAAAGCCAAGATCCAGGAGTGG + Intergenic
1148883683 17:50755244-50755266 ACAGCAGCAAGCTCCTGCAGAGG - Exonic
1151870635 17:76834186-76834208 CCAGCAGCAAGGCTCAGGAGGGG - Intergenic
1152037040 17:77880038-77880060 CCAGCAGCGAGGTTCAGGAGGGG - Intergenic
1152092748 17:78256206-78256228 ATAGGAGAAAGATCCAGGAGGGG + Intergenic
1152214214 17:79023198-79023220 CCAGCTGCAACATCGAGGTGAGG + Intronic
1157231055 18:45916432-45916454 TCAACAGCATGATCCAGGTGAGG - Exonic
1158297752 18:56017797-56017819 ACAGCAGCAAAAGCCAGGATAGG + Intergenic
1160715608 19:575329-575351 CCTGAAGCAAGTTTCAGGAGAGG - Intronic
1161060093 19:2210518-2210540 CCAGCAGCAGGAGCCAGGCTGGG - Intronic
1161587363 19:5112988-5113010 CCGGCACCACGTTCCAGGAGTGG + Intronic
1162494776 19:11017612-11017634 CCAGGAGCAAGGGTCAGGAGGGG - Intronic
1162959814 19:14118862-14118884 CCAGCAGGAAGATAGAGGAGGGG - Intergenic
1162997989 19:14348552-14348574 CCAGCAGCCAGACCCGGGACGGG + Intergenic
1163249842 19:16120130-16120152 CCAGCAGCAGGAGACATGAGTGG - Intronic
1163796734 19:19342271-19342293 CCAACACCAAGGCCCAGGAGAGG - Intronic
1164181528 19:22823153-22823175 CCAGCACATAGATCCAAGAGTGG + Intergenic
1166097646 19:40551069-40551091 CCAGCAGCAGGTTCCAGGGGAGG - Intronic
1167419387 19:49394316-49394338 ACAGCAGGAAGCTTCAGGAGGGG - Intronic
926093421 2:10065072-10065094 CAAGCAGCGAGCTCCAGGGGAGG - Intronic
927424979 2:22971340-22971362 CCAGGAGCTAGAGCCAGGAATGG - Intergenic
927508981 2:23632553-23632575 CCAGCTACGAGCTCCAGGAGGGG - Intronic
927567002 2:24122449-24122471 CCCTCATCAAAATCCAGGAGCGG - Exonic
927917458 2:26946158-26946180 CCTGCAGCCAGACCCACGAGAGG + Intronic
928175461 2:29030751-29030773 CCAGAAGTAAAAGCCAGGAGAGG - Intronic
929921300 2:46173556-46173578 GCAGGAGCAAGAGCCAGGAAGGG + Intronic
932336293 2:70933091-70933113 CCGGCAGGCAGATCCAGGAGCGG - Exonic
932757747 2:74420577-74420599 CCTGTAGCAAGCACCAGGAGTGG + Intronic
934090322 2:88545428-88545450 CAAGCACCAGGATGCAGGAGGGG - Intergenic
935191309 2:100780767-100780789 CCAGCAATGAGAGCCAGGAGAGG + Intergenic
937847817 2:126601110-126601132 CCCTCTGCAAGATGCAGGAGGGG - Intergenic
938289960 2:130143846-130143868 CCTGAAGCAAGAGCGAGGAGCGG + Intronic
938314991 2:130319061-130319083 CCAGCAGGTACATCCAGCAGTGG - Intergenic
938466563 2:131529091-131529113 CCTGAAGCAAGATCGAGGAGCGG - Intronic
938938152 2:136145830-136145852 GGACCAGCAAGACCCAGGAGAGG + Intergenic
939237862 2:139520803-139520825 CCACCAGCACGATCAAGGTGTGG - Intergenic
942845824 2:180423997-180424019 GGAGCAGCAACATCCAAGAGAGG - Intergenic
943076342 2:183200096-183200118 ACAGCAGCTAGCTACAGGAGCGG - Intergenic
944394666 2:199252997-199253019 AGAGCAGCAAGACTCAGGAGAGG - Intergenic
946028335 2:216686057-216686079 CCAGGAGGAAGACCCCGGAGGGG + Intronic
946135334 2:217641870-217641892 CAAGGAGAAAGATCTAGGAGAGG - Intronic
946339654 2:219059309-219059331 CCAGCAGCCAGGTCCGCGAGGGG - Intronic
946371607 2:219284879-219284901 CCAGCACCAAGATCCAGGCTTGG + Exonic
947872250 2:233445741-233445763 CCAGCACCAAGATGCTGGACAGG + Exonic
949046224 2:241873719-241873741 CCAGGGGCAAGAGACAGGAGGGG - Exonic
1168849965 20:969715-969737 CCAGCAGTAAGAGGCAGCAGGGG + Intronic
1172317924 20:33970796-33970818 ACAGCAGAAAGATACAGAAGTGG + Intergenic
1174038074 20:47680391-47680413 CCAGAAACAAGAGCCAGGAGAGG - Intronic
1174354552 20:49989374-49989396 CCAGCAGCAAGACGGAGGTGTGG - Intergenic
1175517490 20:59578333-59578355 CCAGCAGGCAGAGCCCGGAGTGG + Intronic
1175692781 20:61077552-61077574 ACAGCAGCAAGAGCCTGGAATGG - Intergenic
1176047550 20:63100695-63100717 CAAGGAGAAAGATGCAGGAGGGG - Intergenic
1177730820 21:25025087-25025109 CCAGCAGCAGCAGCCAGCAGTGG + Intergenic
1179095801 21:38313671-38313693 CCAGGAGCAAGATCAAGGAGAGG - Intergenic
1179655357 21:42841458-42841480 CCAGCTCCCAGATCCGGGAGAGG - Intergenic
1179985809 21:44919800-44919822 CCAGCTCCCAGATCCAGGGGAGG + Intronic
1180749030 22:18111574-18111596 CCCTCAGTAAGATCCAGGGGCGG - Intronic
1181546866 22:23607143-23607165 CCTGCAGGAGGATGCAGGAGAGG + Intergenic
1182422764 22:30256553-30256575 CCAGCATCCAGACCCAGGACTGG + Intergenic
1182499106 22:30732687-30732709 ACAGCAGACAGGTCCAGGAGTGG - Intronic
1183085593 22:35485057-35485079 CCAGCAGCCAGTTCCAGGATGGG - Intergenic
1183345771 22:37306952-37306974 CCAGCCCCAGGCTCCAGGAGGGG - Intronic
1183548561 22:38468272-38468294 CCAGCAGCAAGATCATGGCCAGG - Exonic
1183708172 22:39487706-39487728 CCGGCACCAAGATGCTGGAGAGG + Exonic
1184176874 22:42793775-42793797 CCAGCAGGGAGGGCCAGGAGGGG + Intergenic
1184571818 22:45329757-45329779 CCAACAGCAAGCCCCAGCAGTGG - Intronic
952137254 3:30437190-30437212 CCAGCAGCAAGCACCAGCAGGGG - Intergenic
952232709 3:31448235-31448257 CCAGCTGCAACAGCCAGGATGGG + Intergenic
953140687 3:40226806-40226828 GCAGCAGCAAGAACCTGCAGTGG + Intronic
954297925 3:49684487-49684509 CCTGCAGGAAGATCCAGGGCTGG + Intronic
961568718 3:127783338-127783360 CCAGCAGAAAGGCCCGGGAGGGG - Intronic
964651715 3:159018656-159018678 CCAGCAGCCAGGTAGAGGAGTGG + Intronic
966869707 3:184282281-184282303 CCAGCAGCAAGTAAGAGGAGAGG + Intronic
967298035 3:187984795-187984817 CACACAGCAAAATCCAGGAGTGG + Intergenic
967405317 3:189109261-189109283 CCATCAGCAAGATCCTAAAGAGG + Intronic
968603205 4:1520153-1520175 CCAGCGACAGGATCCAGTAGCGG - Intergenic
969502881 4:7564306-7564328 CCAGCCACCAGAACCAGGAGAGG - Intronic
971244643 4:24917114-24917136 CCAGCAGCCAGATACCAGAGGGG + Intronic
975808714 4:78141541-78141563 ACTGGATCAAGATCCAGGAGAGG + Intronic
976405815 4:84659563-84659585 CTAGCAGACAGATCCAGGAGGGG - Intergenic
976452740 4:85210415-85210437 CCACCAACAATATGCAGGAGTGG + Intergenic
976498821 4:85762386-85762408 ATTGAAGCAAGATCCAGGAGAGG + Intronic
976734391 4:88295796-88295818 CCAGTAGCATGAGCCAAGAGCGG - Intergenic
978922441 4:114200789-114200811 CCAGTAGCAATACCCAGGTGTGG - Intergenic
979183024 4:117754457-117754479 GCAGCAGTAAAAACCAGGAGAGG - Intergenic
979915035 4:126420917-126420939 GCAGCAGCAAAATGCAGGATGGG + Intergenic
980244126 4:130216256-130216278 ACAGCTGCAAGATGCATGAGTGG - Intergenic
981342205 4:143634561-143634583 CCAGAAGCAAGATGGAGGAAAGG + Intronic
987129916 5:14850667-14850689 ACAGCAGCCAGCTCCAGGAGAGG - Intronic
988706607 5:33732143-33732165 CCAGCACCAGGAGCCAGAAGAGG + Intronic
989165366 5:38428618-38428640 TGACCAGAAAGATCCAGGAGAGG + Intronic
989401174 5:41009198-41009220 ACAGCACCAAGCTCCAGGTGGGG + Intronic
990538565 5:56749320-56749342 GGACCAGCAGGATCCAGGAGAGG + Intergenic
993872425 5:93268146-93268168 CCAGCAGGAACATGCAGGGGTGG - Intergenic
997398115 5:133580778-133580800 CCAGCAGTAAGAACTAGCAGGGG + Intronic
999327256 5:150650934-150650956 CCAGCAGAAGGACCCTGGAGGGG - Exonic
1001544599 5:172563272-172563294 CAAGCAGCAAGAACCAGGGGAGG + Intergenic
1001820052 5:174703427-174703449 AGGGCAGCAAGATCCAGCAGAGG + Intergenic
1002061350 5:176627716-176627738 CCAGCACCCAGAGACAGGAGGGG + Intronic
1003164430 6:3663836-3663858 CCAGCACCAAGATGCATGGGAGG + Intergenic
1003384165 6:5652080-5652102 ACATCAGGAAGATCCGGGAGGGG + Intronic
1007917192 6:45572696-45572718 CCACCTCCAAGTTCCAGGAGAGG + Intronic
1010584439 6:77641485-77641507 CCAGCAGCAGCATCCAGGTGGGG + Intergenic
1011492546 6:87907275-87907297 GCAGGAGCAAGAACAAGGAGTGG + Intergenic
1012159691 6:95868693-95868715 CCAGTAGCAAGATTTAGGACAGG + Intergenic
1012863108 6:104585309-104585331 CCAGCACCAAGAGCAATGAGTGG + Intergenic
1013692717 6:112665472-112665494 CCAGCAGCAAGAGCCTGGGTGGG - Intergenic
1014045020 6:116875919-116875941 CCAGCAGCTAGATCCAGGATGGG - Intergenic
1014712010 6:124817377-124817399 CCAGCATCCAAATCCAGGTGTGG - Intronic
1014875125 6:126648971-126648993 CCAGCAGGGAGATAGAGGAGTGG + Intergenic
1015969379 6:138729074-138729096 CCTTCAGCAAGATCTAGCAGTGG - Intergenic
1017324469 6:153130509-153130531 CCAGCAGTAAAATACCGGAGGGG - Intronic
1017812568 6:157994601-157994623 CCAGCAGCGAGCTGCAGGAATGG + Intronic
1019490435 7:1310824-1310846 CAATCAGCTAGCTCCAGGAGAGG - Intergenic
1020968261 7:14900432-14900454 CCAGAAGAAACATCCAGGAGAGG + Intronic
1022679580 7:32531813-32531835 CCTGCAGCAACATCTAGGTGGGG + Intronic
1023427425 7:40053202-40053224 CCAGAAGAAAGATCAAGGATTGG - Intronic
1028334602 7:89636435-89636457 CCAGCAGTAACAACCAGCAGTGG + Intergenic
1029127176 7:98302606-98302628 CCAACAGCAAAATCCAGATGGGG + Intronic
1031246561 7:119320739-119320761 ACAACAGCAAGTTCCAGGAAGGG + Intergenic
1032168018 7:129561009-129561031 CCAGAAGCCAGATCCTAGAGTGG - Intergenic
1034398448 7:150845814-150845836 CCAGCATCAAAGTCCAGAAGTGG + Intronic
1038624688 8:29179646-29179668 CCAGCAGAAAGAGCCAGAAAGGG - Intronic
1041772677 8:61488872-61488894 CCATCTGCAAGTTCCAGGATGGG + Intronic
1042670661 8:71259390-71259412 CCAGTAGAGAGCTCCAGGAGTGG - Intronic
1042915869 8:73875586-73875608 GCAGCAGCAACATCCTGGTGTGG + Intronic
1045013897 8:97982001-97982023 TCAGAATCAAGATCCAGAAGTGG + Intronic
1046134180 8:110004861-110004883 GCAGGAGCAAGATAGAGGAGGGG + Intergenic
1046968966 8:120199440-120199462 CCAGAAGCAGGATCAAGGACTGG + Exonic
1047225547 8:122952946-122952968 CCAGGAGCGAGATCAAGAAGTGG + Exonic
1049234929 8:141507734-141507756 CCAGCCGAAGGAACCAGGAGCGG + Intergenic
1049247302 8:141569689-141569711 CCAGCACCTGGATCCAGGGGAGG - Intergenic
1049250958 8:141588779-141588801 CCAGCTGGCAGATCCAGGAAGGG - Intergenic
1049528329 8:143140956-143140978 CCAGCAGCAACTTACAGGAGCGG + Intergenic
1050110483 9:2210311-2210333 CCAGCAGGAAGATGCTGGACTGG - Intergenic
1050426427 9:5516801-5516823 CCAGTAGCAGGTGCCAGGAGTGG + Intronic
1050454944 9:5825376-5825398 CCAGCAGTAAGTTCCATGAAGGG + Intronic
1051121901 9:13760736-13760758 CCAGCCTCTAGATCCATGAGAGG + Intergenic
1053446371 9:38156278-38156300 CCTCCTGCAAGATGCAGGAGAGG + Intergenic
1053475102 9:38377098-38377120 TGAGCATCAGGATCCAGGAGTGG + Intergenic
1053516241 9:38733208-38733230 CCCTCAGCAAGATCCAGGACTGG - Intergenic
1053549397 9:39060031-39060053 CCAGCAGCCAGGTCCAGCACTGG - Intergenic
1053573755 9:39336758-39336780 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1053612794 9:39732203-39732225 CCTGCAACAAGTTCCAGAAGTGG + Intergenic
1053813512 9:41880105-41880127 CCAGCAGCCAGGTCCAGCACTGG - Intergenic
1053838376 9:42165315-42165337 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1053870836 9:42490165-42490187 CCTGCAACAAGTTCCAGAAGTGG + Intergenic
1054085460 9:60738952-60738974 CCTGCAACAAGTTCCAGAAGTGG - Intergenic
1054095321 9:60895442-60895464 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1054116783 9:61171366-61171388 CCAGCAGCAGCAACCAGGTGGGG - Intergenic
1054123389 9:61282251-61282273 CCAGCAGCAGCAACCAGGTGGGG + Intergenic
1054240721 9:62610187-62610209 CCTGCAACAAGTTCCAGAAGTGG - Intergenic
1054554855 9:66644711-66644733 CCTGCAACAAGTTCCAGAAGTGG - Intergenic
1054590970 9:67011195-67011217 CCAGCAGCAGCAACCAGGTGGGG + Intergenic
1054617084 9:67307334-67307356 CCAGCAGCCAGGTCCAGCACTGG + Intergenic
1055455845 9:76470870-76470892 TCAGCAGCTGGATCCAGGAATGG + Intronic
1055917257 9:81417378-81417400 ACAGCAGAAAGAGCCAAGAGAGG + Intergenic
1058634737 9:107025400-107025422 TCAGCAGCAAGATGCAGGTTAGG + Intergenic
1060343539 9:122797406-122797428 ACAGCAGCAGGGCCCAGGAGTGG - Intergenic
1060508503 9:124215763-124215785 GCAGCAGCATGGTGCAGGAGAGG - Intergenic
1061814952 9:133188966-133188988 CCAGCAGCCAGACCCTGGGGAGG + Intergenic
1062144375 9:134980748-134980770 CTGGCAGCAAGTGCCAGGAGAGG - Intergenic
1062405010 9:136392026-136392048 CCAGCATCAACAAGCAGGAGTGG - Exonic
1186513178 X:10146489-10146511 GCAGCAGCAAGAGCCGGAAGAGG - Intergenic
1188000905 X:24980456-24980478 TTAGCAGCAAGAGCAAGGAGAGG + Intronic
1188147243 X:26629530-26629552 CCAGCAAAATGATCCAAGAGTGG - Intergenic
1188166354 X:26869584-26869606 GCAGCAGCAAGAGACAGGGGAGG + Intergenic
1191715377 X:64190496-64190518 CCAGCAGGAAGATTCAGATGAGG - Exonic
1197147932 X:123189465-123189487 ACAGCAGAAAGACACAGGAGGGG - Intronic
1200141645 X:153905565-153905587 CCAGCAACAGCAGCCAGGAGAGG + Exonic
1200325476 X:155233785-155233807 CCAGCATCCAGATCAAGGACAGG - Intronic