ID: 1102950561 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:117028100-117028122 |
Sequence | CCATGGCGTCACAGGATGAA CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 115 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 107} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1102950561_1102950569 | 28 | Left | 1102950561 | 12:117028100-117028122 | CCGTTCATCCTGTGACGCCATGG | 0: 1 1: 0 2: 0 3: 7 4: 107 |
||
Right | 1102950569 | 12:117028151-117028173 | CTTTCCCTATAACCATGTTTAGG | 0: 1 1: 0 2: 2 3: 14 4: 169 |
||||
1102950561_1102950570 | 29 | Left | 1102950561 | 12:117028100-117028122 | CCGTTCATCCTGTGACGCCATGG | 0: 1 1: 0 2: 0 3: 7 4: 107 |
||
Right | 1102950570 | 12:117028152-117028174 | TTTCCCTATAACCATGTTTAGGG | 0: 1 1: 0 2: 1 3: 14 4: 164 |
||||
1102950561_1102950566 | 4 | Left | 1102950561 | 12:117028100-117028122 | CCGTTCATCCTGTGACGCCATGG | 0: 1 1: 0 2: 0 3: 7 4: 107 |
||
Right | 1102950566 | 12:117028127-117028149 | TCACTACTACGACCTCGCACTGG | 0: 1 1: 0 2: 0 3: 1 4: 17 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1102950561 | Original CRISPR | CCATGGCGTCACAGGATGAA CGG (reversed) | Exonic | ||