ID: 1102950563

View in Genome Browser
Species Human (GRCh38)
Location 12:117028108-117028130
Sequence GTGAGTGGCCATGGCGTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950563_1102950570 21 Left 1102950563 12:117028108-117028130 CCTGTGACGCCATGGCCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950563_1102950569 20 Left 1102950563 12:117028108-117028130 CCTGTGACGCCATGGCCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1102950569 12:117028151-117028173 CTTTCCCTATAACCATGTTTAGG 0: 1
1: 0
2: 2
3: 14
4: 169
1102950563_1102950566 -4 Left 1102950563 12:117028108-117028130 CCTGTGACGCCATGGCCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950563 Original CRISPR GTGAGTGGCCATGGCGTCAC AGG (reversed) Exonic