ID: 1102950564

View in Genome Browser
Species Human (GRCh38)
Location 12:117028117-117028139
Sequence GTCGTAGTAGTGAGTGGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950564_1102950575 28 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950575 12:117028168-117028190 TTTAGGGATGTGCCTCAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1102950564_1102950569 11 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950569 12:117028151-117028173 CTTTCCCTATAACCATGTTTAGG 0: 1
1: 0
2: 2
3: 14
4: 169
1102950564_1102950570 12 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950564_1102950574 27 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950564 Original CRISPR GTCGTAGTAGTGAGTGGCCA TGG (reversed) Exonic