ID: 1102950565

View in Genome Browser
Species Human (GRCh38)
Location 12:117028123-117028145
Sequence TGCGAGGTCGTAGTAGTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950565_1102950570 6 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950565_1102950576 29 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950565_1102950574 21 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1102950565_1102950575 22 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950575 12:117028168-117028190 TTTAGGGATGTGCCTCAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1102950565_1102950569 5 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950569 12:117028151-117028173 CTTTCCCTATAACCATGTTTAGG 0: 1
1: 0
2: 2
3: 14
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950565 Original CRISPR TGCGAGGTCGTAGTAGTGAG TGG (reversed) Exonic