ID: 1102950566

View in Genome Browser
Species Human (GRCh38)
Location 12:117028127-117028149
Sequence TCACTACTACGACCTCGCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950563_1102950566 -4 Left 1102950563 12:117028108-117028130 CCTGTGACGCCATGGCCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950557_1102950566 19 Left 1102950557 12:117028085-117028107 CCCTCTCCCTGTCTGCCGTTCAT 0: 1
1: 0
2: 0
3: 21
4: 300
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950560_1102950566 12 Left 1102950560 12:117028092-117028114 CCTGTCTGCCGTTCATCCTGTGA 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950555_1102950566 29 Left 1102950555 12:117028075-117028097 CCTTCCAGAGCCCTCTCCCTGTC 0: 1
1: 0
2: 5
3: 68
4: 488
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950559_1102950566 13 Left 1102950559 12:117028091-117028113 CCCTGTCTGCCGTTCATCCTGTG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950561_1102950566 4 Left 1102950561 12:117028100-117028122 CCGTTCATCCTGTGACGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950558_1102950566 18 Left 1102950558 12:117028086-117028108 CCTCTCCCTGTCTGCCGTTCATC 0: 1
1: 0
2: 2
3: 24
4: 254
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17
1102950556_1102950566 25 Left 1102950556 12:117028079-117028101 CCAGAGCCCTCTCCCTGTCTGCC 0: 1
1: 0
2: 7
3: 96
4: 870
Right 1102950566 12:117028127-117028149 TCACTACTACGACCTCGCACTGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950566 Original CRISPR TCACTACTACGACCTCGCAC TGG Exonic