ID: 1102950567

View in Genome Browser
Species Human (GRCh38)
Location 12:117028139-117028161
Sequence TATAGGGAAAGGCCAGTGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950567_1102950576 13 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950576 12:117028175-117028197 ATGTGCCTCAGTTGGGAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1102950567_1102950575 6 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950575 12:117028168-117028190 TTTAGGGATGTGCCTCAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1102950567_1102950574 5 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950574 12:117028167-117028189 GTTTAGGGATGTGCCTCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1102950567_1102950578 23 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950578 12:117028185-117028207 GTTGGGAGCAAGGAGAAAAATGG 0: 1
1: 0
2: 3
3: 54
4: 576
1102950567_1102950570 -10 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950567_1102950579 24 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950579 12:117028186-117028208 TTGGGAGCAAGGAGAAAAATGGG 0: 1
1: 0
2: 4
3: 40
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950567 Original CRISPR TATAGGGAAAGGCCAGTGCG AGG (reversed) Exonic