ID: 1102950570

View in Genome Browser
Species Human (GRCh38)
Location 12:117028152-117028174
Sequence TTTCCCTATAACCATGTTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102950565_1102950570 6 Left 1102950565 12:117028123-117028145 CCACTCACTACTACGACCTCGCA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950561_1102950570 29 Left 1102950561 12:117028100-117028122 CCGTTCATCCTGTGACGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950567_1102950570 -10 Left 1102950567 12:117028139-117028161 CCTCGCACTGGCCTTTCCCTATA 0: 1
1: 0
2: 2
3: 6
4: 142
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950563_1102950570 21 Left 1102950563 12:117028108-117028130 CCTGTGACGCCATGGCCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164
1102950564_1102950570 12 Left 1102950564 12:117028117-117028139 CCATGGCCACTCACTACTACGAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1102950570 12:117028152-117028174 TTTCCCTATAACCATGTTTAGGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102950570 Original CRISPR TTTCCCTATAACCATGTTTA GGG Exonic